Description :
From Genome Similarity Track
Location :
Scaffold_652:14489- 15492
Transcript NameFunction/comments
g8927.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TCCAGCGTCGACCACCGCCCAAACATGCGCCTTCACTACATCCTGCTCGTGGCTGCAGCCACACTTCTTGCAAGCACCAACGTCGTCTCTGCCAGTGCCG
ACTCCGCTCAGATCAAGCTCTCAACGACTGGGACTGGCACCGTCCCCGCTTTTCGCTCGCTGGCTGGTGCCTCCAGCGAGGTCGGCGGTAAGAGGTCTCT
TCGAACCGCAAAGGAAGACGAAGCCGACGACGAAGCCGACGATGAAGCCGACGATGAAGCCGACGAAGAGAGGGGCATCACCGTTTTCTCGAGTGGGACC
TCCGCTAAAAAGCTGCGGGGTTTCCTGAAAAAGAACAGCATCATCAGCAAGGAAACCTCCAAACTCTTGAAATCCTCTGGCTTCAGCGCGGACGAGATTG
CCTCTATGTACGCCAAGTACGTTAAGCTTGCTTAGCGGTCCGACGGGAATCCTACAACTCAACGGGGGCCATTATCGACACTCCTGCACTAGATGTTGAT
AGCGGAAGTAGTACCGGGTTAAAAAGCTAACGTAACAATAACCAGCTCATCCGCGTTCGCCTAGACTATTCCACAACAAGAAGACCACTGCTCTGAGTGC
TACCACATTACATGTCCGAACAACCTAATATCAGTAGCAGTCTGGAACCCACTGTGTCGTACAGGGAGTTGTTTTCGTTGCGGAGTAACTTGATCAGGAG
AGAACGAGCGAGGGCTTTTGCTTGTAGTCCAGCGGTGATCAGCCTTTTTGTGTCGGCGTACCTTCATGTCCCGACGAACAATCCCATTCAACGCATACGG
GAGCACTTCGTCCTCACCCACGAAGTCACATGCGAAGCATGCCTATGCCCCGCCATCACATAACTCTCCTCGCCAGTAGCGGAATTCCGTGTACATGGCT
TTATTCGCTGGCGTTTCGACGATGATTGTACGGGACGATACAGAACCAATTTGCGAAATGCCGTGTCGGCACTGTCGCGAGAATATACGCCCCCAAGACG
TCC