Description :
From Genome Similarity Track
Location :
Scaffold_66:144871- 165684
Transcript NameFunction/comments
Phyra_52194PREDICTED: O-phosphoseryl-tRNA(Sec) selenium transferase
Phyra_81971eukaryotic translation initiation factor 3 subunit p
Phyra_5219514 kDa zinc-binding protein
Phyra_71973HD repeat domain-containing protein
Phyra_81974kinesin-associated protein, putative
Phyra_81975AlNc14C393G11300
Phyra_71974ADP-ribosylation factor 2
Phyra_81977charged multivesicular body protein 5, putative
Phyra_71975ATP-binding cassette sub-family F member 2

Sequence
20813 bases(100 bases per row)
TAATGAACGCGAAGAGCGCTGCACTGGCGGAGGCGTTGGTGCCGGCCACGTACGTGCAGCAGGGACTGGATGCTGTACGCGGGCGGGAGAAGCTGGTGAT
GACGCTACTTTCCCAGCGCCGCCTCCCGGACGACGGCTGGGACGACACCAGTGTGGAGCTGCTGCTGCACACGCTCTCGGCCATGGACAGCAACAATTTC
CGGGGCAGCGCCGGCGCCGGCGAGCGCGAGGCGCGCGTCTTCTCTGCGCTGGTGGCTCACCGCCATTTCAACTTGGCGCACGGCGTAGGCAGATCGGGTG
ACGTGGCGGCGGTGCAGCCCAAGGCCGCGGGGTCGTCTCTCATGGTGCAAGTGGCCAACGCCCTGGCCAGAGACGTGCTGCGTCTCGCTGGGATGCGTGC
GGTGCAGGCGGCGCTAGTGCTGCCAGTAGCCACGGGCATGTCGCTTATGCTGGTGTTGCAGCAACTCAAGGAGGCGAAGCCAATTGCGCGCTACGTCATT
TGGCCGCGGATCGACCAAAAGTCCTGCTTCAAGTCTATCCTGGCGGCAGGACTGACACCGCTGGTGTTGGCGAATATTTTGGTGGAGGAGGAAGGAAAGA
AACCAGGAGGATACTTGAAGACGGACCTGGCAGGCATGGCAGCACTCATGGATGAACATGGCAGTGACAGCATCGTGGCTGTGATGAGCACGACGAGCTG
CTTTGCGCCGCGCGCGTACGACAGTGTGCAGGATATTGCCAAGCTTTGTCAGGAACGCAACATTGGTACGGTACAAGTGGGTTGTGGATGCTGGGCTACT
AGCTGATGAAAGAAATTGCTGTGCTGGTTTATTGTTATGGTGTTGAAGCACATGTGATCAACAACGCGTATGGTGTTCAAGCATCCAAGTGCGTCCACCA
AGTGGAAGTAGCTATGCGCACAGGGCGTGTAGATGCCGTGGTGCAGAGTCTCGACAAGAATTTTATGGTCCCCGTAGGTGGAGCAATTGTCTGCTCAACA
TCGCGAGATGTTGTTGACCGCGTGGCGAAATTTTACCCGGGGCGAGCTAGTGCCACCCCTACGTTAGACTTCTTCATCACCATGCTTCAGATGGTAAGAT
TTACCCTCGTCTTTGGCTGCTCTCTAACATTATTTGTGTCTGGCTCATGAATCTATCAGGGGAGGAGCGGATATCGACGGCTTCTTGACGAGCGCAAGCA
GCTTGCAGCTTATATGCGCGAGCAGCTTGAAGCATTAGCAGCAGAGGAAGGCGAGCGCGTGCTACACGTCTTCAATAACGAGGTACGGGGATAGCGATTT
ACTTTCAGTTCATCGAGTTTGATAAGTCGACCCGTTTCGTTCGTATGCACAGATATCCTTTGCGCTGACGCTAGGCACATTCTGCTCGAATGCCAAGGAT
CTGCAAGAGAAATCTCGGCAGCTTACGTCGCTTGGCGCAATGCTCTTTTCGCGTGGAGTGTCTGGTGCACGGTAAGTTCAAGACTAAGCTTAACGTTGAG
TTGGAATTGCTATCGGTCATCTGACGCATGCATTGCCTCAGAGTGGTGTCGTGTCTCGATAGCAAGACAATAGCTGGACACAACTTCAATTCATTTGGAG
CGCACCACGACGCATTTCCCGTGGCCTACGTTACTTTTGCCTGCGCGTTAGGCATGCAACAAAACGAGGTCGATCTGCTCGTCACGAAACTGCGCAAGAC
GATCCACGAGTGGAGAGCGAAGCAGAGCAGGTCGATGGCTGCCGTATAACGTCGCCACTCACCTCAAGTACATGTAGTTCAGCACTGGAGAACGGAAAGC
AGTCAAAATGTTGACTACTGTGTCTATAAATCTGTTTCCTGACGTGCTATCTTTTCCTATTGCTCTCTCCTTTCACTAACACAGCAGTCGCACTGAATTG
CCTAGTGCTTCTTACTGCCGCTCTTCGTCTTCCGAGTTTTTTTCTTGGCCGCAGGCGGGGATCCTGCCTGTTGGTCAGCCTCCGTCTTGAACTCAAGCTC
TCCAAGCAACTCGTTGGCAATGGCATCAGCAGCCGCAGCGGCATCCCCTTCACGGCGGCCCTTCGCGCCCTCCACAGCCTTCTCAGTGAATGCAGCCATA
AACTTGGCCGAATCGATCACACGCGGATCTTCCTCACCGTATGCCTCCTTGAAGAGCGAGTACACCTTCTTTTCGTACGTGAGGGCCTCGCGGAAGCCAC
CGGCAAGTCCACAAGCCATAGCCATCTGGTGGAGAACATTCGCAGCCTGGTTGCGGTCAAGCTCGCCGCGTCGGAGAGACTCGCGGTGGCACATCAGTGC
CAACGTGATCTGCCCCACATCTTGGCACATCATACCCATCTTAAAGTAGAGTGAGCTGATCTCAGGGAAGTGAGGTCCGCAACAGAACTCCAGCAGGTAA
ATGGCACGGCGAATGTGTGGCACCGCCAAATCCGTTTGGGCATTGGCGTGCAGGAATAACGACAGGTTGGCGTGTGCGAAGGCCGTGTCGTGGTAGTCGA
TGCCCTGAAGCTGTGTGTACAGAGCGAGCGCTCGCTGCTGCTGTGCGATAGCACCGACAACGTCGCCAGCGTGATAGAGGACAGTAGCGAGCGACGAGCT
GCAGAGAGCTGCATCCTCGTGGGCGGCACCACACACCTGGAAGAGCAGAGATGAAGCCTCCTGGAGGAACTCGTACGCACTCGACAGCGCTCCTTGGCCC
AAGTGCTGGCGGCCACGCTCCAGGAGCTGCTTGGCCTGCGCGAACGGGTGCGCAGGCAGCGAGTGCTTCACGACCGGCACCACGCCAGTGATGTCATCCA
GGCTAATCGGCGTGGCGCACGACGATGAGAAGTCGTAGTTGCGGCTCACCACACGCAGCCCCAGACGCTGGCACAGACGTCGCAGCAAGACTATTCTGTG
CGCGCGGCCCACTGGAAAGGTGGCGTCATCAGCACTGGCCTCGCCACGGCCAGGACCCCACAGGGCCAACTTGTAGTCAAATCGGGCCTTAATCTCCTTG
TCAATGCGAGACCAAAGCGTGTTAGCATCCAACGACGCCGTCGTAGTAGCAGCGGCATCATCAGTCTCGAAGACATCCTTCTTGTCCGCAACAGCAGAAG
TCGATCCAAGAATGCCGTTCAGGAGCTTCACAATCGCCGATCCTGGGGCAGCACGAATGGAGTCGTTGGAGTTCAGAACATCAGCCAGGATGTGTTTGGC
AACGCGAGATATCATTTCCACCTCGAGCACTTCCAGAAAGTACTTGGAGATACCGCCAATCGCCTCCAGCTTCTTGGCAAGCAAGGCCAGACGACCCAGG
TAACGCATATTGATGCCGCAAGAGTGCATCAGCTGCGTGAGCGAGTAGCCATCCGCAGGGGCGCTAGCGCCACGGCGCACGTCGGCTACAAACGCTGGCA
CAACAATCCTCTGCAGATACTCAGCAGCATCTTTCGCCGCTGTTTCATCAGCCTCGAGCTGCTCCGCATTCGTTGAAGCCGCATAATCCATGAAGACGTT
CGGGTTCAAGAGCACCGGAGGAACCGCAGCCGTCTCCTCTTCCTCATCGGCCTCCTCAGTCTCCTTCTTCTCGGACGTAGCATCTTCCTTCTTCTCAGTG
TCAGCCTCAGCACCATTCTCCTTATTCTCATTTGCTTCCTCCGCCTTCTTCGCTTCCTTTGCTGCAATGCGAGCCTCACGGTTGACACGGCGGGCTTGGT
TCTGTTTCCAAAGCGAGTACAACTGGACCAGTTCCGGGCGCAGCAGAGCCGCGTAGCCTTCGTCGTTGCGAGTGAAGCACAATCCATCTTCTTCGGACGG
AATAGACTTCTCCTCCTGTTTCTTTAGTGCAGTGTCGCGGCTCTTATAAAATGTCCAATCCTTCGGCGTGATGCGGACCAGATCCAGGACATACAGACGG
CCATCAGAGCCCTGGATACCCTTGGCCTCCACAGCACCACAGATGGTTGCCACATCGGTGCTTGCCTCACCACCGCTACCAGGTGCAACACCAAGAGCCT
CCTGTTCCTTCTCAACGGCCAGGTCTTCTTCGGTCTTACCAAGAGGCTTAATGCTACGCTCTGCAATGTGCAGCTTCTCGCCCGCCTCGAGCATGAGCTT
GTGCATCTTGTTGTTGGCAGCAATGGTCTTTCCGTGGTCCACAGAGCCGTACACCAGCTTAGAAGCTGCATCTCCCATCAGGATGCCCGGGATAATACTC
TGGGCAATAACACGGACACCAAGGTAGTCCACAACCGTCGTGGCCAGGGTGTGGAGACCACGGACATCCGCCTCGTTGAACGCCTTCACACCTTGCAGGT
CTCGGTTGGCAGCCGAGTAGGCGTTCTCCTCTCCTCCAGCGGCATCTTTGGTGGAGTTGCCGTCGATCGACATCGAGAAGAAAATGTTGTTGAAAACGTA
TACGTGCGCACTCTTGTCGTCCATGGGGTTGATAGGAGGAATGTGTCCCTCAACGATAGCAACCGAGCCCTGGGTTGCTGCTTCCACGAACTCCGTCACA
ATCTTGTACATGACACGAGCGCGCACAATTTCGTCCTTCAGCGAGTCGGTCGACAGCTCACGGCAGCATTGATACTCCTCGTTCCAGTCACGCAGCACGC
CACGCTCATCCATGCCGAAGGACGCGCAAAGTTCGTCTTCAGCGCGATTGAGGTCGTACGTGTGCTCCTCAGTCGCCGTGGCAGCAGGGGTGTTCCACGG
CAGCTTGCCACCCAAGCTTGATCCAGCCGCCACCATCCACTCGATAGAAGAAGGCCCCTCCTTCGCCAGAGAAGCAGCCTTAGCAAGGAGAGCAGCGTAC
GACTCCCTGAACTTCGGCGATACGGAGCTCAACACATCCACCAGCAGATGCGCGTGGGCCGCAGCGGTCTTGTGCGGACGCGGGTCGAACTTGGTGGCCG
TCGAGCGGTTCACAAAGAACCCATTGACGTGCGCCGTGATGTGGTAGCGCGTGTTATCGCCAGCAACCACCACCTCCAGGTAGAGCAAGTCACCCGCGAG
TTTGCGGGGTCCTGGCGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGACACAGGTAGGGAGTTTGGCATCCTGCTGCTTCTGCTCCGGCTCCTTGTGT
TGGTTGGCCTCGTTCTGCTTCTGCTTCAGCTGGTTCTTCTTCCCTTTCTTCGCCTTCTTCTGGTCCTTGGCCGGCGTTGGCTCCGCGTCCTCCTGCGCGA
CGGGGGTTGGGAAGGCGTAGAACTCGGCAAGCTCGGGTTTCACTGGGACTTCGACCCCCTCGAGCTTGTGGTGGATCTCGCGCAGACGCTTGAGCTGCTT
TTCGGACATCTCCTTCAGCGCCTTGTCGTCCGGCTCCTCATTACTGGTATCGGCCACACCTTCCGGCTGAGCCTCGGGCTCCGTGGCTGCCTGGGGGATG
GGCGGATTGTTTAGCACGTCCCGGAAGCGACGCACATGGCCGCGCACCTTGCGGGCGTCGAACTTGTCCAGTGCCATGCGCAGCGTCACGCCGTCCGCCA
CACTCTCGTACTCGCCCAGCTCCACAAAGTCGTTGAGCGGCTGCCAGGAGCCGTCCGCCGAGCTCTTGGCCTCCAGGTGGTAGCTCGTGTAGCATGCGAG
CGCTGGGAACTCGGCGATGAGCTGGCGCAGAGACACGACCGTGTCCGAGGCCCCCACGCTTTCGAGCCGCACGCACTGGCCGCTCTTGGCGGCGGGAGGC
GCCACCAGCACACTGAAGGTTTGCTCTTCCAGGGCCAGGAGCTCTGCCGGCTGCTGCTCTGCCGGCTGCTCGACGGTGTCGCTGCTGCCCATGATGCGTG
GAATCTGCTTGCTTTACGGGGCTGTCGTTGCGATCTGAGCAATTGTGTGGTGCGTGGGCAAGACCGAAAAGGCTGATGGACCATTGCAAAGGGGCAATGG
CAAGACAGTCATTTACCGAATTTGTTCAAGAATAAGTAGTGCCTCGTGCTGGTCCGATAGCAAAAGTCAGTCAAACGGGTTTGACGGGTATGCTATATCA
GAGGCTTGAAGTTGTCTTTCATCTTCAGATTGTGGCAAATCACTTGGTGTTTGTAAGAGATCAGGCGAAGTACGTCATGTATCTGGCAGACGCACCGGAA
AAGCCCACCGAGAATGGAGAACATCTTGGCACTGGAGCTGTAACGAGCACCACGTCAAGCCACATCTGGGCACTGGAGCTGCAACGAGCACCCCGTCAAG
CCCGCATGCCTCCGTTCACCCAGCATGAACAGACTTTGCATCAACCACCAGCACCAGCGCTTTTGTACCAGTTTTGATGGATACGTTGGTGTGTGCCACA
CACAGACATGCTCATCCGAGCCCTTCGCCGCAGCTTCCTGGCGTCCGGACCTACCTCGTTGTCGCGTCGCTCACTTGCGCCCTTCACCTGCCGCACCATG
AGTTCCGATGAGCGCGCCCAGGCCGACGCTGCGGCCGCCTCGGGTGCTGCCTCCGCCGTGGGCGAGACCATCTTCGACAAGATCATCAACGGGCAGATCC
CGGCCAAGATCGCGTACGAAGACGCGCAGTGTCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCGTGCACATCCTGCTCATCCCCAAGAAGCGCGACGG
CCTCACGCAGCTCGCGCACGCCGAGGAGCGCCACGAAGCCGTGCTAGGCCACCTGCTGTACACTGCCAATCTGGTCGCCAAGCAGCAGAACCTGGACAAG
GGCTTCCGCATCGTCATCAACGATGGAGAGGACGGCTGCCAATCGGTCTTCCACCTGCACCTGCACCTTCTTGGGGGACGCAAGCTGGGCTGGCCTCCTG
GATAAACGAGGGCATCGGCCGCCGCCCTGTGTCAATGAGGGCCCATGGACCTCTGCGAATTATTCAGGTACAGGCGTGTATGTTTGAGGTAACCAATGCT
ACGATGCTGGCCTACTACGCGTAGTTACTTGGTCAACGTTATGGCGGTCTTTGAGGGCGCCACTTGGTTGTCTGGGCGGTCTATCCTCGGCCGCTGATCT
CTTTGAGGAATTGATCCAGGAACGTCTCCATGAACGCGTGGCGCTCTTCTGCCAAGCGCTTGCCGGCGTTGGTCTTCATCATGCCGCGGAGCTTCAGCAG
TTTCTGCAATGACAACAAAGTTCCCAGACGTTAGACAAGAGCACCACCGGAATCAGACAGCGACGTACCTCGTAAAAGTGGTTGATCGTGGTGTTGGGGC
GGTTCGGGTCCATGTACTGCTCCTTGGTCATGTCGTCAATTGGAGGCACATCCGGGTCGTACAGCGGCCGCAGCTTGTGCCCTCCGAACGTGAAGCACCG
TGCGATTCCAATGGCTCCAATCGCATCCTGCACGTCAGAAGCGGAAACGTTGTCAATCAGCACAAATGTCCGTTGCTGTTAGTGGACAGATAACCTACCA
GTCGGTCGGCATCCTGGACGCAGCCATATTCGATCGAGTACGATCGCTGGCAACACCAAGCAACGAACAGCATTAGCCACATGACTCCCATCCAACCAAA
CCATCGCCACTCAAAAGGTAGCATACCGAGCCGCTGCCAGCCAGCTCCTCCTTGAACCCCATGCTGTCAATGATAGTCATCACGCGCTCAATCTTGTCGC
GGGGCACGCTCTCCGACTGCAAGAAAGCCACCGCGCGCTTCGTGGGCTTGTCCTTGTCGCTCTGGTATTTCCAGTCGTCGATATCGTGCAGCAGCGCCGC
CAAGTCCACGATCTCCAGACTCTCCGCTGGCACTCGCTGTGTGGCACACGATGCACCCGTCAGCAACAGTCACGCGCTCCCAATCCTCCGCTGCAGCAAA
CCTCCTCCCTGGCCAGCGTCCTCGCCACCGTCCACACGCGCTCGATGTGGCGCCAGTCGTGGGACGCGTCGTTGCTCTTGAGCTGCTGCTCCACGAACGC
CGCTGTGCGCTGCACCAATCGAGAGGTAGCCATCCTGGTCCGAGGCAAATTGCGCAATGAACAAGACAAAGCACAACCATCAGCTGTCGTACAGCGCCGC
CACTTGGGGTTCGAGTTGCTGCTGCTTGGCGCGAACATTGCTCGTCTCTGATTGGCTAACTCGCACACCTTCAACATTGAAACTCCCCGCAGTTCCCCAA
GAGGCAGCACCATGAGCAGCTCCCGTAGCCGGGGCCCGACCCATGCGGCGGTGACCGCCAAGAGCGAGCGGCCCCGCAAGATCACGGCCAAGGCGGACGA
GCTGGACGCTTACATGGAGAAGCTCTACGACGACGACGTCGAGTCTAAGCTGGACGGGGCCAAGATGATTCTGCAGCTGGCCGAGTTCGCCGGCAACATC
GAGGCACTCGTGCAGAACGAGTCGCTCATGGTGCGTTCGGGTGGGAATAGCGTACTAGTTGCGCTGCTGATTGCTGTGTTGTTGCTTAGAGCCTGCTGTC
GCGCGTTCTGAACGACGACTACAAGAAGAGCTATGACTTTTCGCTTACCATGATGCGCATCTTCTGGTGCTTCTCCAACTTCTTGCAGCTGCATCCAGTG
CTGGGCAACTACCGCATCGGAGCCATCACACTCAAGATCGTCGAATTCGAGCTCAAGCGCCACCAGCTCCGGCAAGAAGAGGAGAAACTTCTCGAGAGTG
CAGTCAACGGAGCCCCAACAAAGGGAGAATCAACTGACGGCATCCTAGCGAAACTAGACCGCGAGAAGAAACGCAACAAGAAGCGTATGAAGAAACAGGA
CCAACTACTGTGAGAATCCTTCGATGGCAGCGGGATATTTGTGACTGACTCGAAAATTCGTTCTTGTAGCAATGTTTGCTTCAGCGTGTTGCTCAACTTG
GCCGAGGACATTCACACGGAGCGCAAAATGGTCAAGCGCAAGATTGTGTTTTTCCTGACCAAGGTTCGTGTCTGTATTTAAGCTGCTGGCCGGCTTGGAT
GTCAAACGTTTGTAACTTACATGGTTTATTTGCTGCGTAGCTGCTGGATCGCGTGGCTCCTGACTTGGTTATCCTTACGATCACTTTCCTCAAGAAGCTG
AGCATTTTTGAGGAGAACAAGGACGCAATGGTGGAGCTTACCGTCGTGGAGAAACTCGTTCGCTATCTCAACTGCAACCACGACAAAACAATCCAGACGG
CACTCAAGCTGCTGTTTAACCTTTCTTTCGATCCAGCTATCCGTGAAGTGCTGGTGCGGAATAGCCTTATTCCAAAACTTGTGGAGCTACTCAAGAAACC
TCCCTTTCGTGCATTGTCACTGCGGATTCTCTATCACCTAAGTATCGATGATCGATGCAAGTCCATGTTCACGTACACGGAGGCTATCCCGATTGTCATG
CAACTCGTGATAAATTTTCCGCAGAACATCGTGGCAAAAGAGCTGGCTGCTCTGGCGGTGAACCTCAGCCACAATGCGCGCAACGCCGAGCTCATGTGCC
AGAACCGCGGTCTAGAAGCACTTGCAACACGCGTGTTCCGCACGCGTGACCCGCTCCTGATGAAGGTGATCCGAAACATTTCACTTTGGTCATATACGCT
ACAAGAAGACTTGGTCAGCGATAAGGCGTATAAGTACCGTGGTATGTGGGCTCCATTCGTGGTTCCGTTCATCGAGCTGTGTATCAACACCGACAACCAC
GACTTTTCGATCGAAGTTCTGGCAACGCTAGCCAACATGACACCTAGTGATTTGCCTCCAAAGACATCATGGAACAAATTGGTGACGGATCAATCGTTAA
TCCCTTTCCTCAACAAAATGCTGGTGCCAGGCTTTTCGCAAGACGATATGATTCTTGAAGTCGTGCTTTTCGTTAGTGCACTCGCGCTGGAACCGAAGTG
TGCTCCTCTCTTATCGTCATCTCGGCTGGTGCGCACGTTCCACTCGCTGTTCCAAGAGAAGCAACACGATAACGAGCTCACATTGCAGTTGCTTTACGCG
TTCTACCGCATGCTTCGCCACCCCGAAACCTTTGAGGAAATTCTCTTTGGAGTAGGGTTTGTGCCGGACTTGCTTCTCGCTGCTGATGCATCAAACATTG
AAGTCCGCCGGATGTGCGACGTGCTCATGGACTTGATTCTCGACCACGATCTCAATGACGGTGCCATCGGCGACTTTGGACACCTCATTCGGCAACGCAG
GTTTGAAATCCACAACGCTGAGTATCTCGAAATGATCCATGCAGAAGCACAAAATGCAAGCTACCGCAAGCACCACGGAATGGATGACAATGGTGGCAAG
GAGGACGACGATGACAACTAAGCGGCCAGAGTATCATCATCCGGAACCAGTCCAACTCATTAAAAGACCGCGTATACTTCTGTAGCCAGACTTAAACCTT
TAATCCTTGCGGTAAACTGTTCCACGCAGTATTCTTGCCTGCAACGATCCTACTTCACAAACTCAACTAATCCTTTTCCTCGTCAGGAACCCAACCACGC
TCTTCCGGTCAATGCCAAAGCGAGGCAGTGCCTTTTCCGGCCAATACGTATTGTCCTCGCTGTTAATGGACGCCCCCGGTGGAATCACGTACATGCTGTA
CGGACAATTTGGTGATATGGTCATTGCAAGCGCGCGAGAGTTGTGTTTCCTTTTGTCCGAGTAGCGAACGAGTTGCCGCACGAATTTCCAATGGTCATAC
GCCGACTCTAGACAAAAAAATGTCATAGCCGATTCATGGAGATTACGCACTTCTGTCTCCAGTCTTTCCATCCCGACAGTTCCTCGCTGCGTCACCACTA
TACTTGGGCTCTCGGGAAATGCTTCAGGGATCATTCCGTCTCGCGTACGGCACCAGAAGGCATCCACGCGAAACTCATGGTAAGTGTTGGTATCGGATGC
GTCCTGAATCTGGATACAGCATGACCAAGCGACGGAGTTCCGGATCATTGGATTGTCGATCTCCATCTTTTGATCTTCTCCCTCGGGAAGCTTTGAATCA
AGGCCACAATCAATCAAATCAATGAAAAACTGTGCTGCTCTCCACTCAGCCAAGCGACGGGCCTCCGCTTCTGTTTTCCATGTAGCTCTACAGAGAGCAT
GGCCATCGACTCGAACGACACAGTGCACACCAGGGGGTGAGCGAGAATCTCTGCCAAACGAAGCACGAGGAGGATCTTCCACAGCAGTTGTTATCTGTTG
CGAAGCACACTTACGGTTAGTTCGAACGAGTAGCATTCATAGCGAAGAAATACACGTACACTGGCGATGCCTGACAGCTTTAGAGCTCGAAAGGAATCCT
CAGATGAAACATAGGCCAGAGATTTCACGTCCAGAAAATGAAGAAGTTGAGCCCAGATCGAGCGGATCCTGTTTAGCCTGTCCAACATGCCATCGACAGC
AGCATTACAAGCTTCAGGCTTCGCCATTTTCGATGCTTTGAAGCGGATGACGTCGTTGACATCAACAAGAACTTCAAATACGCCTTCTCGCAGGCGTTCC
ATGCTGATATTTGCCGTGACATTGGGGACAATTCTTCTGTGTTCAGCCCCCCGGTACTTCAGCGATGCTCGAAGTCTGTTAATACCAGCGCATAATTCAT
CTGTTGGTGTAAACAGACTTCGAATTGCGGCGCGAAATTTGCCATCGTCGGTGTTCTCGCTCTCAGACACCTCATTATAGTTTTTTTTCATTTCATTCTC
AAAGGCTGCCTCATCTGCTGCAGCGCTGACATCTTGTGAGGCTTTGACTGCGGACGGATCCCAGTCATCATCAAACCCACCGTCTGAATAGTTATCGTAG
TCGTCGTCGTCCATCTCATCGTCGCTGCACAATACGAGATTAGACTTCTTCACTTGAGTTGTTGTCGGGGGGCGAGATTGGTTCGTTCCTGTGGATGTCG
ATGCTGGTGCTGCATTTGTTGTGTTGTTGCTTCCATTTGAGGAGCACGACGGGGTAGATACGGATATCATCTTGTTCAATGATTGCAGGATGTCGCGCCA
TTTTTCATTTGCAGACCGTTTGGCATCTTTCGCGTTCAGGCATGCTGTCGAAATGGCCAGTGTGTTGCGCACTCGAATGAAATACATGTACAAGGGCGGA
ACGAGCTTTTCCGACGCCGAAACCTGAAAGGACCTTGTGTTAGTCTCCCTTAGGGCCAACAATGCAGTACTTCGAAGTAGTTAGCCAGCCGTACCTTGTC
ATGATTCTTTGCTTGCGTTTCGTTGCCTGCCATCAAAGTTGTGGGCGTTTCAATTAGTCGTTCGTTGTACGTGACGAGCAACGCTTTCCACGTTTCAATC
ATCCCATCCAGTGTGTTTATCAAAACAGAAATTGCCTTGTCCTTCGCGATTTCAATCGACGACCCTTCTCCTTTTGCTTCGACCACGCCTTCGGATGCAG
AAAGCACACAGCTAACAAGACCACTGTTTTCCTTCGTAGCAATCCGGCGGATCTGGAATGCAATGTAGACATCACACTAAGTAAAACGTACTAAACTATA
CGAAGCAGGAAAAATACCTTCCGATACATACCGATAGATTGGACGAAAGCTGAATAGTTTCGGACTGCACACGCAAATTCCACACGATCGATCTTACAGT
TTGCTCGGTCCTCTCCCGATCTCGAAATAGGAACATCAGAAGTTCCTGGTAAGCGTCAGATTTTGCTTTTGAGGCTTCATCTTCGGAACGAGGGGGTCCA
TCACTATTGGCCTGCGAGCCGCTTCGATCTTCAATGAAGATGTTTGCTTCTGCTTCGGCACCAGAGATTCTCTCAGCTCTGTTTTCGGAATATTTCCTTT
CAGGAAGTGGTGGTATTTCGGATTCTGGGGCTGAGTACTCCAGTCGGGGACGAGGAGCACCACGCTCGTCCTCGTAAGTGTCATTTGCATTTGGTGCGTA
GTGTCGCTTTCGTAAAATGCCCATAGACCTTAGCTCAGCATCTCTCGAGCCGACATTTTCGCTGCTCACGCTGTTTTCGCGCATGGAATCCACCTCGCTG
TGGTTATAATATGGCTGGGCATCTTCAGTCGCGCTTGGCTCATAACTGCTGGTCCACGCATCTCCATGGTGGGGTTGAACACTTTCTATCTTGGTCGGTT
CAAAGTCGTTCGCATGGTGCTCTGCGCGGTCGAGCATCAGACTCTCCTCGTGCTGATCAATTAATTCCATCAGGAACAGCATCAGTGCGTCAACTGTCTC
ACTTTTAACGCTGGGTAAAGATGAACCACGCCTCCAAACGAGTGGGAGCTCTTGGATTAGAGCAACTACGTCATAGTTAGTATCGTTATCAGTGGGCTCT
GCAGTGGGTTTCTCGTACAGCTGCACAATCCAATAACTTATCAGTCTAATATCAACATGCCAGCCAAGCAAATGTGCGTACCCGAACAATTTTCTTCGAG
ATCAGATAGTTGAAAGATGCATCTTTCACCCTTCTGGTATCATTCGCGATACAGAGGCCGAATTGAGACTTCAGATGCAGCAGCATGCCGCCATACAGTC
TTCGATGTTCAACTACAGCCCTTGTAAGCTGCGACAAAGCTCGGATAGTTGCATCACGATCGACAGATGCAGTGCACTCAAATGACAAATTTCCTAGTCG
AACCCGAGCAATGTACTGGGCCGAATCAACCATCCGCAACTCTCGCCGAAGCTGCGCGGAAACAACCGTCAACCAAAGTATTCAGGGAATGAGGAAAACA
GAGAGCTTACCTTGAGTCCCGCAGCCAAGATAAACTCTTTACTCATTGCTGACAGCGACACAGTTTGGACAGCTTTTCCTAGTCCTTGAAGCGATGACAC
GAGGTCGATATTAGGGCCAACCAAAGCAAGGAGGTACGATCGGCCCTCCTCAACACCGAAAGTTCTCTGCTTGGCGGGGATACTTTTGTCACTCTGTTGG
CCCTGCTGAGTGGGTGGAGGAGGTAGAGGTGCTGGAGTCGGTGTCGGAGCTGAAGCTCTAGCGGCCTCAGAGACTGGCTCAGTCACGCTTACATGGATCG
GCGCGGCATCTATAGCAAAAGTCACCCGTTTCTTCGGCGCAGTCCGTGCGGCAAATTGAGAACCTTTGTGGCGCAGTATCGACGTAGTGCTCGGTGCACC
GGCAGGGTTGCTGTCATAGCTCTCGTCGATCGTATCGACTGCCATGTCCACAGGTTCCTCAGCCATGTCCACGTCCTTGTCCTTGTCCTTGTTTGCTCCG
TTGCCCACCCCCTGCTCACGCATCAATTCCGCATACCACTTCCGGAATTTGTCGGCGAATTGGAACTTCCTGTCCTCCATCAACGTGTTCCTCATGTCTC
CCGTCATGATCTTCACGTACATCAGCAGCTTCTTGGCCGAGTGTAAGCGCTGCACTGCCACTCGGTCCTGTCTGATCAGCCCCTCGTAGCGTTCAGCCAA
CTGCTGGTGGTGCGTGTCCATCTCGTCCAGGAGGCGGAGAACGCGACCAGGCGTGCGTCCCTGTCTCGGATCGTCCCGAGCCGCCGCCCCCATGCGTACG
AAGCGCAGCACAACCGTCCTCCTCGTCGCCTTGTCCTGCTCCTGCTTAATGTGAACTTGTGCCCCAATAGCAGCCACGTCCTTATGCAGCTGCTTGAGTT
TCCTGGGGCACAAGAGGAAGTCCTCGATGCCCATTCCCACGAAATAGTCGTCCGGTTCCACGGTGCAGATGGGCTCCAGGGCAGCGCATTTGCCCGCCAC
TTTGTCCTCGAACGCCATGGGAAACTGCGGCGGCGCTGTCTTCTGCACTTGGAACAGGTGCGAGCTCATGATGGCGGTCACTGACACGCCCATGCTCGCG
AGCTGCAGGTCGCCAACGGGCCCACGGGGAAGCGAGTAGTGCACCTCGAAGGCGCGGCCTAGTGACAGCAGCTTGCGAGCAGCGAGCGTCGTCTCCACGC
GCCACAGACGCACGCTCATGTCGAACGCCAGGTCTTGGTTGAGCTCGGGAAGCGGCTCCATGCTGTCCGCCCAGGGCGCCATGTTCCAGGCTCTGCCGAC
AACTGGATGTCACTGTGTGTGGCACTACGGAATGACTGGATTTCACTATACCAGTTGGTGCCAAGGGTGACAATGCTCGCGGCTTGTGTGTGTATTACTT
ATGTTAATACTGTCTACTCCATGAGGAAGATGCGGCTGGCAACGTCGCCGACGAGCCAGTCGATGCCGTCCACGAGGCCGTCGCCAGTGACGGCGCTGCA
CGAGACGATACTCCAGTGGCGGGTGGAAAACTGAGCCGACCGCAGCCCCAAAGCGTCTGCGATCTCCGCGGAGGAGAGAGCGCCAGGCAGGTCCTGCTTG
TTGGCAAAGATGAGCAGCGTAGCGCCTGCTAGTTTCTGCAAATACGGTAGCAGCCAGCAGTCAGAGAAGCAGCAACTTCAGGAGGATCTTATGAACGCAC
CTCTTGCGTCAGCAGACTCGAGAGCTCGCGCTTGCAGTCTTCGAGTCGCCGTCGATCGGCGCTGTCCACGACCCACACGAGGCCATCCGTCTGTCGAAGC
ACACATCCACTGTAAGCTTCCTTTATACTTCAGTGTATACAGCCTGCCGCTTCCAGACCTGCTCGAAGTAGTTTCTCCAGTACGAGCGAATCGTTTGCTG
TCCGCCGACGTCCCAGACATTCAACTTGAAGCTGGCAGTGACAGCAACACAGCGACCATGAACCTCGCACTTGCACAGAACCCACCGCGCACACTCACTC
TTTGTACTCAAGTGTCTGGATGTCGAACCCCAGCGTTGGAGAGATCTCGGTGATGTCCTGGCCCATGAACTTCTTCAGGATTGTCGTCTTGCCGGCGTTG
TCCAAGCCACTACAGCAACAGCAAGCGCGTCAGCCCCAGTAAACGACCTCTAGCACTAAGAGTGAAGATAGCAACGCACAGCATAAGGACTCGGATCTCC
TTCTCCTTCTCCTTGACCTTCTTGAGGATACTCAGCAGCCCCATGATGCGATTCGCCTTGGTGATCTAAAGTAAATTGCCGAACGGGAAGTAATTTATTT
GTAAACTACCGTCACGAAAGGGCATGAAACGACGCTTACGTTAGGTAGTTCAAGCGCAGCGCAATTGCAGTTAGTACTACGTAGTCGATACGCCATGACC
AAAGCCGCCCCACCTAGACGCTTACTGCTGAAGAAGTGCGATGGGAACCAGGAGGACGTAAACGCTTTCGATCCGAGCAGTCGGTCGACCAAGGCGCATT
TCCCCCTGCAACAGGAGCAGTCTTCAAAAGAAGATGCAGATCCGTTCGAGAGCAGAAGAGCTTGCAGACACACGTCATTGGAAGAGCTACTAGATCTGGA
ACTGGATTTGATCCTGCCTGTCACTGCAATTCCAGCTCCGACGAGCAACCAGTTGCCTGTTTGTGCTGCAAACGAGGAGCTGGAGGCCGACGTCGACTCC
GTCTCACTGGAGCTGCTGGTACGAACGAGCGAGCAACCATAGTCGTAAATGACAACTCACATGACTCGTATGTGTTGATGATGCAGGCGATGCAGAGCCC
ACACGGCGAGAATCAGCAATGGCTAAGCGAAGAAGACGAGCAAGACGCGAATTCCGTGCCAAGCGCGATCACCGTTCGACCAGAGGAACAGTCTCCACGG
CCTACTGTGAAAAGAGCGTCGGCTTCTAGAAAACCGATGGCGCTTCATCTCGTGTCGCCGACAGCGTTTGTACCATCGTTCCCTCCATCACCGAGCCAGT
CGTCGACAGACGAGGACTATGGTTTAGCATCGCCGATGGCGCTGCCAGACACACCTTCACAGTCTCAATCAGGGATCACTTTAACCTGGGACCTTGCACC
AACCTCTCCTACCTACGAAGATACTTATACAAGAGCAGGAACTTCTCGTGGATTCGCACAGTCCAAGAGCGTCCAAAGACCAGAGCGTCGAACCCCTCGA
TTTTCAGCTGCAGCTAGAGCTGCAACACCAAACCCACGAAACCACGGAAGCTATGCACCGGACCGAGCTACGGCACGGATAACACGGTCTGCACTTCCAA
CGCTACCGGAAGGCCGAGGCAAGGCTAGGCATGGCGGAATCTACTCATTGTTACTCAAGAATAAATCTGGGAAACAGGAGCCGATGCTCGTTGAGGACGC
ACACAATTCCGACGGTACGCTGCTGTGGTTTGATGGTACAGAGGAAATTTTTGGTACTGATTTCTATCCCTCAGATATGACTCAGGCGCCTTCCGTTTCT
AAGGCGAGTGCGTGCAAGCAAAAACACGGAGGTATCTACAAAATGCTGAGAAATTATAAATAATTTCTCATGTTATACACGGTTCTCTCGTTTTCTCTCT
TAACGCTATCCATAGCTCGAGTTTCATTTCGTGCCGACCATCCTGGATTTTGTGGATACACATGTTACCCGGTAATTTACCCTGTAATCTATTCTTTTTT
TTGCTTATTGCATCATCAAGAGAAGAGCGCACCGAGATGAACCGCATTTTCGGCAAGAAGAAGGCCGAGGCACCCTCCGTCAACGTCTCCGATGTAGGGG
GAAAGGTGGACGCGCGGATCACCGACCTCGACATGAAGGTAAGTGGCTGGGACTTGCGCTGCGGCTAATGAGCGCCGCTGACCGAGTAAACCCCAGATAG
AGAAACTGGATCAGGAGCTCCGGAAGCACCGGGAGCAGATGAAAAAGACGCGGGGCCCAGCGCTCAATACTGTGAAACAGCGAGCCATGCAGACACTCAA
GCGGAAGAAGATGTTCGAGGCGCAACGGGACAAACTGACAGCCCAGTCCTTCAATATTGAGCAGGTGCCTTGGACAGATTGACGGGCGTCTGATGGGCGT
CTGAGGCTGGTACCGAACGCTGATCCTGTGCGTGTATGCTCCGCTATCGAACTCTCTGGATTGCAGGCCTCGTTTGCCATTGACACATCAAGGGACACAA
TCTCAACTGTGGCTGCCATGAAGAGCGCAGCGGTGCAACTGAAGGCAGAGACACAGAAAATCGACATTTCCGAGCTGGAGGTGAGACTGGCCACATTAAC
TATGTTGCGTATAGCGAGCTATTTGCTGATGCGCCCTGTGCGATTATGCGTGGAGCAGGACGTGCAAGACGACATGGCGGATTTGATGGAGGATATGAAC
GAGATCCAAGAGATCATGGGGCGCTCGTACGGGTACGTACTTGCAGCACCTTATCACTGCTTGCCTGAAGTCACAATGCGAGCATATCTGACCGTGTGAT
GTTCGGGCATTTTTGCCTATCTGCAGCATCGGCGACGAAATCGACGAAGACGAGTTGGAAGCGGAGCTGGAGGGGCTGGAGGAAGAGTGGGCTGAGGAAG
AGGCGCTTGGAGAGGAAGCAGAGTCGGCGCCGTCGTACCTTGCACCAGCCCAGCACCACGAGCTGCCTGCCGCCCCCTCGGGCATCTTAGACTCGGGTAC
CACAGCTCGCGCTACCGACGAGTTCGGGCTTCCCGTAGCGTCCTACTCTACGTAGCGCTGCAAGCTGCACACCCAGCAAAACACAAGACCTTACCAATAC
ATTTGCAGCACATTCGCAATACAGCCATGTGTCATTGCGCAGTTCGTGTCGCTGTCAGCCAAGCGTTGGATCGTGGCCACGCACTTGTCAAACATGGACC
GGGAGAGATGGCTACATTATACCACGTCAGCGGAGCTACGCTATTGGCCGAGCTTAGACAGCCAATCATTTTTCGGAATCACGTTTGACAGGGTAAAAAA
TGAATATTACAGGATATGTATTATCACAAGGTGGTCATTGATGTATTTGTAAAGCAAGTGTATCTTTCCCTCGCACGAATTCGTTTATATCATTCGCGAG
GTTTTTTATCCCCGAGGTTTTATCATTCCAAGCAAAATTTGGTTGCGCTCACTTTGGTATTGGTGGTTTTGGCAGCGCTTCGTCCAGATTCCAAGCAGCA
GTCTGGCAGGTATGGCCCGCGAAGCAAAGGAGCCGCGCGTGAAGCGCGAACGCAAGGGAAAGAAGGAGTCGCGCAAGAAAGCGGCCGAGGAGAAGAAGGC
TGCCGAGAAGGCCGAGGCGCTCGAGAACATGTCGCACGCCGACCGCTTGGCCGAGGAAGGCATCATCGCCACGTGCTCGCACAACGTGCGCTCGGTTCAC
AAGAACTTCAAGGACATCAATGTGCTCAACTTCAGTATCACGTACTTCGGCAAGGTGCTCATGGAGGAGTGCGACATCTCGCTCAACTTCGGCCGGCGCT
ACGGCCTCATCGGTCGCAACGGTTCGGGTAAGTCCACCTTCATGAACGTGCTAGGCGCGCGCGGTATCCCCATTCCGGAGAGCATCGACATCTACCACCT
TAAGCACGAAATCGAGGCCAGTGACATGACGGCGCTCGAGGCCGTGCTCTCCGTGGACGAGGAGCGCAACAAGCTCCAGGCCGAAGCTGACGCTCTCTCG
GAGAAGATGACCGACGATTCCATCAGCGAGGAAGACAGCGAGGCCATCTCTGACCGTCTGACGGACCTGTACGAGCGTCTCGATGACATGGACGCCGCTA
CGGCCGAGGTCCGCGCTCGTCAGATTCTGTCGGGTTTGACGTTCTCGGACGCCATGATGGAGAAGAAGACTAAGGAGTTTTCCGGTGGGTGGCGTATGCG
TATCGCGCTCGCCCGTGCTCTGTTCATTCAGCCGACCCTGCTGCTGCTCGATGAGCCTACCAACCACTTGGATATGGAGGCTGTCGTCTGGCTGGAGGAC
TACCTGTCCAAGTGGAAGAAGATCCTGCTCATGATTTCGCACTCACAGGAGTTTATGAACGAAGTCTGCACGAACATTATCGATCTCACCAACAAGAAGC
TCGAGTACTACAATGGTAACTACGACACGTACGTGCGCACCAAGGCTGAAAAGGAGGAGAACCAGATGAAGCGTTACAACTGGGAGCAGGAACAGATCAA
GCACATGAAGGAGTACATTGCCAAGTTCGGTCACGGTTCCGCTAAGCTTGCCCGTCAGGCTCAGAGTAAGGAAAAGACGCTGGCCAAGATGGTGCGTGAC
GGTCTCACGGAGAAGGTCGAGCAAGAAATGATCGGTGACTTCAAGTTCCCCAACCCGGAACCGCTCCCTCCTCCGGTTCTCATGTTCCAGAATGTGGCTT
TCGGTTACCCGGATTGCCCCCTGCTATACTCCGGCGTTGAGATGGGACTTGACCTGGATTCCCGTGTGGCTCTAGTCGGTGCCAATGGTACTGGTAAGAC
AACCCTTCTCAAGCTTATCACAGGAGATCTGGTGGCGCGAGAGGGTAACGTCCGACCACACAGCAAACTTCGCATTGCGCGATTCAGCCAGCACTTTGTG
GATGTGCTGGACCTGACGAAGACCCCGCTTGAATACTTCCGCTCGCTCTTCCAGACGAAGTCTGTTGAGGATGTCCGTAGCTACCTCGGCCGCTACGGCA
TCACCGGTGAGGTGCAAACACAGATCATGGGTCAGCTTTCTGACGGACAGAAGAGTCGTGTGGTGTTTGCGTACATGGCGCAGCAGAATGCACACATGCT
GCTGCTGGATGAGCCCACGAATCACTTGGATATGGAGTCTATTGATGCACTGGCTCGCGCTATTAACAACTTCGAGGGTGGCATGTTGCTGGTGAGTCAC
GACATGCGATTGATTTCGCAGGTCGCCAAGGAGATTTGGCTTGTAGAGAACCAGTCTATCAAGGTCTACCAGGGTGAGATTTCCGACTTCAAGATGCGCG
TGCGTAAGCAGCTCAAATTGGCGGACAAGGAACCTGCCAAGGGTGCCGAGTAAATGCTCATGATAGCTTTCTTCTCATTAGATCACCTCTACATGTAGAG
CTGTTGAGGCAACCGCTGAAGCATTTTCTTAGCACGCTGTTCTGTTCATATTTGATTCCCTTGCCGACAGATAACATAGATTGAAAAATCACACGTTGGT
AGTTGATGAAGTT