Description :
From Genome Similarity Track
Location :
Scaffold_7:144851- 148727
Sequence
3876 bases(100 bases per row)
TTGAACTCGTACAGCAAAGCTCCATAACTTAGCTGAGACATGGGAAGCCACTCAGTGTCAGGGTACCCCTTCCACTTGACCAAGTACTCCCGGACTCTCC
GTGAAGTCCGGGTCCGCTTAACCCAGCGCACATCCTGAATGACCTCCACTTCGTACACATTCTGAGCTTCATCGGGTTCTTCAGCATCTTCATACAACAG
AGCTGCGTCCAGATCATCATCCTCAGCAACTTCAACCTCAACTGTAGGTCGTTCAGGGAACAGGGCACGCGGCTTGAGTCGACTTATGTGGACGCAAGGA
TACAACTTGTACCCAGTCCCTTCGATCTTCAGCTTGCATCGGAAGTCATCTGAGGTCTCCAGAATCCGGAACAGACCGTGCCAGAGGTGAGCGAACTTCT
TCGTGAACCCAGGTTGCACTCGAGCTAGGTATAGCCACACAGCATCACCAACTTTGAAACCCTTCTTGAGTCTCTCAGACAGCTCAGCCCAGATTTTTGT
CTAAGCAGCTGAGCGTTTTACCTTGGGCTCAGCTTGAAAATCCTTAGCCCAGGCCTAAGCGTACTCGTACTCGCGCTGAGTCTTGCGATGCCACTCATAG
GCAGTCCTCTGATCCAAACCCGTCGGAGATGGTCCCAGCATGGCCGAAACAGTGCTGTGAGGGTCCCAGCCATGAACCAGGTAGAACGGCGTGTCTAGAC
GGGTGGCGTCGAAGGACGTGTTCAGAGCCCACATCAACTTCTCTACCAGGTCGTCTGATCTGGCTCAGCGACGTACGCTCGGATAGCTCTGACCACTGTT
TGCACTGAGCGCTCTTGCTGACAATTTGCCTGAGGTCTATACGCCAGAGTCGCACGCTGCCGGCTCCCCAGCATCTCGCGGAACCTGGCGAACACCTCAC
TCATGAAACATGGATCACGGTCAGGGCGGAGCAGAGAGCTCGCACCAAACCTCTGGAACACACACTCCATGTAGGCCTCAGCGACATCTTGGGCTGTGGT
CAGACTCATCGGCTTGCACATGATGAAGCCTGAGAATGCACACTGGAATAGGACCAGGAACACATTTCCACGGTCGGACTTGGGTAGATGCGTAACGAAA
TCCATAGAGACCACCTCAAAGGGCTTAGTCGCCAAAATGTTTCCCGGCGACGGCCCAGGGTTGGGCGGAGCTCCCTTGGCAGTGACACAATCCACACACT
CCTTCACATAGCGTTCCACCTCGGTGTACATCCTCAACTAGTAGTACTACCTGCGCAGTCGTTCGAAGGTCCTAGTGATCCCTTGATGACCACCTTGGAA
CTCCTCATGGCTGAACTGAAGCAAGTCATCTCTCAGCGCCGTTGGCACAACCAATCTCAGATTCCCAGCTTCGTCCCTGGGCCTCCCCGGAGTAGCCCGA
CTCAGATAGTACAGGACTCCTCTCGAATCAAGGGTGAATTGGTCCACCACCTTGACCACATCTTCAGCCTCAGTAGCTGAAAGATTCCCCAAGTCTCCGT
TCAGATAATCCTTGAGCTTCTTCGTCCAGGGCTCAGCCCCCTGCAGAACTAGGATGCGTCTCCATCGTTCAGCGATTGACGCAGCAGGAGTTGCCGCTTC
AGGTGAGTGCACTGGAGCTTGCTCAGCGGGGAGCTCAACATTCTGGTCGGGATCGACACTTTGATCGGAGTCGTCCCTGGCTGTTGTGGTTTCAGCGTCC
CTGACCCGAGCTTGGTTCCTAGTCACCACGAAGATCATAGCGCTGGGCAGCAGGGGCTTGGCAGCATCCTCCAGCGGAGTTGGCTCAGCCACCACTTCCA
CATCAGCTTGAGTGTCAGGCTGCTCTGTCTCAGGTTCAGCAGGCTCAGGTTCATTCACCTTGATCAGCTTCTCCGGGATCCGATTCAGTTGTTTGAGCTG
AACCAGTTCAACCGGATCCTCAATGGTGACAGGACCTTGAATCACCAGCGTCTTCGACGTGAGGTAGTCCGCAACTGCGTTATATTCTCGCTTCACATGT
ACCAAGCGCAATCGTTGGAACTCTGGGCGAAGCGTCTCAAACTCAGCCAACAGCACTTGCAGCCCTGGGCTCAGGCACTGGATCAAGCCCTGAGCTTGCT
GAATGACAAGCCGAGAGTCACCGACCACCACGAGGTCTTAGATGCCACGAGCTTTCGCCATGCGAACTCCCTCGACCAGTCCATGGTACTCGGCTTCGTT
CACCGTAATGCCTTCGAAGTGGATCCTCGAGCTTCAACCACATCCCAGGACACAGAATGCAGCCAGAAGCACCAGAGTGATCCGAGAGTTTGGCAGCTCC
ATCAAAGCTGAGCAGCCATCCCTCGTAGTCCACCTCCAGCATCTCCAAGCTGATCGGTGGGGCTCGGACAACTCGTCCCTTGTCTGGGATGAGGTTCTCT
GCGATCTTGTCCAACTGTTCACGGGGGGTGATCCCAGCTCCCATGATCGCGGCCAAACCATCTTCATCGCGTTCGACCTTGTGAACTTCCAAAGGCCAGG
GCGACAGACGTGCAGCCCACTGCTCACAGCGTCCCTCTAGAGACCGATACTTGAACAACCATTTCAGAACCGTGTAGACCTTCAGCAGCTTGCAACCACT
CAGCATCGAGTAGAAGACTCTGAGAACTCGGAGCAACGCTGCAACCTCCTTATCAGCCGGGTGGTATCTGAGCTCCTGATCATGCAGTGTATCGCACCGG
GAAAATGACTCCATCGTACGCTTGGCCCAGCACCGCACAGACTGCCCAGGGATTAGCGTGTAGAATAATCACGAACGGCTTCTCCCTGTCCGGGTGTCTG
AGCAGCGGGGTAGAGACAATCTTCTGCTTCAGGATTTCAAACGCCTCCATAGCTCGGCCGAGATCACGTCCAGCTTGGATCTGCTCATCCGTCAACTCGT
AGAGCACAGACGCTACAGCCGGGAGGTCCTCAATAAACTTGTTGTAGTAGTTAAGACTCCCCAGGAATGACTGCACTCCTTTCAACGTCGACGGGAACGG
CAAGTCCTTGACTCTTCGGCTTAGCTCGGATCCCCTCAGCTCCAATCTCATGCGAGAGGTAGGAGATAGACTTCTTGCCAAACTCACTCTTGAGCAAGCT
CACCGAAATTCCCCAGTACCTCAGTCGATAAAGCAACCGGTCCAAGACTTCGCACATCTGGTCCCAAGTCTCTGCTCCATATGCGATTTCATTGATGTAG
GAGCTTCGTCCCAGAACAGGACTCAGCTGAGGCGGGGCCGGAATGTTTCGCCGGAACACGGTAGTCTCCTCAGACAGAGGAGGGATTTCTTCCTCCTTAG
CGGAGTCGTTCACCTCGATGCCTAGGAATTCCAGCACGTCCGGACCAACTCGGGCCTCCTCGCAGGGCGGAAGTCGCACGAAACCCCACAGACAATTATC
GAGCATCTGCTGGTAGATCAGTGGGGCGTTCTTGTGACCAAACGGCATGCGCTTCCACTGGAAGTGTCCCAGCGGACAGATGAAGGCTGAGATCAGCATG
GCTCGGAGTGGCATCGGCACTGCCCAGAATCCGCTGGCCATGTCCAAGCTCAGGAACCACATCGCTTTCTCAAACCCGACCAACAGATCGTCAATCAAGG
GCAGAGGGTAGTGTGAGAGCTTGATCAGTTAGTCGATAGTCGAAGCACAGCCTGATGTCCACACGTTCTTCTTCATCCCAATGACAATTGGCGAAGCCCA
ATCTGAATGTGAATACTCGATGAGCCCAGTCTCCAGCAGCTTCTTGATCAGAGCAAATACCTTGTCGAGCAAGTGTGTCGGAACTTGCCGATTCCTCTGA
GCTATGGGCTTCGCGTCCCCAATATCCAAGTCACAGACAACTCCACGGGCAGGGGCTGGTACTGCATTCCCGTCCC