Description :
From Genome Similarity Track
Location :
Scaffold_155:14484- 19081
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.16Chromosome 03 contig 1, DNA sequence
Pytul_var.sporangiiferummaker-pug3_contig_155-snap-gene-0.27Carbohydrate-binding protein

Sequence
4597 bases(100 bases per row)
TTCAGAATTTCACGGTCGGTGTCTCGTTCGGCGCCACGCGCGACGCCGCATTCGAGCACGCGGACACGCGGACCGTAGTGNNNNNNNNNNNNNNNNNNNC
ATCCCGCAGCCCGACGGCTGCGTGTACGCGTTCGCACGCGACACGAACGTCATATGGCGCCACGGCATCCTGCAGGATGCGCCCGTGCGCGACGAAGGCC
GCATCTCCGTCATTGCGTGGGGCTGGATCGACGGCATGGTCGACCCAGAAGCGGCCGTCACCAACACGCCTTAAGAAGAAAAGAGCGTGAAGTAGTTCAT
GTGAGAGAGAGACGTATGTGTGTCATGGCGTGCGTACGTTAACGAAGCAATTGGAATAGAACAAAGTGCGACGCGCTTCAAGGTGTCGCCTGGCTTTGGC
ATGAGTAACATCCACGCAACATGGATTTACAGGTCGATGGCGACAAACGTCTTCTTCTTCACACTGCTGCTCGCTACTGCGGTTGCCGTACTGATCGTCG
CGCCATTCAACTCGGCGATGAGCGCGTTGCGCTTCATCTGGAGCTCGTCTTTTCGCGCGAGTTTCTTCTTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGACAGCGCCTTGGTTTCCTCGTTGCCCCCATCGTTCGCTCTTGCTGCGGCTTCGAGCTTGGCGATCTCCTTCAGAAGCTTGTTGAGTTTGGTC
AGTTCCTGTTTCAACGCCGCCGTGCTGTCGCCACCGCTTGCCTTGGCGTCATCGCGTACACGAGGAGCTGTTGACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTCTCGAATTGCTTGGTCGCGGCTTCCGCTCCTGTGCTTTGCTTTCCAGCGACAACGACGCCAGTGACAACTCATCTGAATCCGCCGTA
TCTGCCGCGCTCGTTGCGGTCTGCTGTTGCGGAGCGCCTTGCTTGCCTGCGGCTTCAAGCGCTTCTTGCTCACGTCTCTATCCACGCAGTAAGAAAGCAC
CGCGTTAAAAGCGCAAAGTGAACAGTGCATGTTTCAAGACACCGCAAACGTATTCATGGGACACTCACGCGCTGCGCGACGGTCTTGTACTTGGGCACCT
CGTCCTGCGCGACGTAGCCCTGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGCGTTGACGATGCCATCATTTTCCAGATTTGGGATTTTCCTTTGGAGAAAAAAAGGGACTGTAATAGAGG
GCGGGCGGGCCACCCAAAATTGCGGAATTGGATGATAATAATGGAGAAAGCGCAGTGAAGACGCATGGAGAAAGACGGCGCGCGAAGGAAGAACGGAGGA
GCATGAGGAGCAAGAGCTGCGCGTGTGCGCTGCGTGCCGTTGTCACTCGCCTGGTTGCTGCTGCGGCATGGTGCCGTACCGAGTGCCGACGAGTGCGGAG
GCGCCAGTGTGTACGCGATCTTAAGAGTCGAGAGTGTGCCCTTGGTGCTGAAATTGTATTGTGCAGGTGGCGAAGGTGTGTGTTGTCTCGTCGCTACATG
GATGAAGGCCCCATGGCGCGGCGTTTGCGCGATAGGTGAGGTCGTCACGACCGCCAATTCGTAATCTGCTCTCTACTCTGTAGTTTTGGGTGTTGCTGTG
CTCGATCAAGCACTCTCGAAGGTGCTGTGCCGACGAGCTCAAGCGCATCGCCTGCGCGACGACGCCTTTGGTCAACGCATCCCAGATATCAACACGGGCA
TCGAGATCATCCAAGCCCAAGACGAGTGACCCGTTGTTAGTTGTGGAGAACGCGTGCTTTCGGCCAAAATGCTGGGGGCAAAACGGTCTCGTGCCGCCAT
GCTGCGCAGCGAGGAGAGCAAGGCGAACGATCTCCTGCTCTCCTGAATGCATGGGCGCAAGTGCGTCGGTAGGTGATAAATCGTCGAAAACATGTGTGTT
GCTTTTCCATGTACTTGCACCATTGTACTCACTACTAGTACAATGTACACACGCCTACGTTGGACTTTTATGTCTACAGAATGCCAAACGGTGTCCTTGG
CGTTGTGGCTAATTGGGCAGGTCTCGCAGTTGACGATGCTGATGCTGGAGTACCGTGGCGGGTGGTAGTCGCTACGAGGTACATGTCGCCTCTCGTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCTCGTTGAGCGATGCAACGATCGCACGCGGGCCTGATGCTGATGCCACGCGACTTGCTGCA
TGTGGTGGCGCATCTGGCGCTGCTGCTTGGCGCGATACGCGACCANNNNNNNNNNNNNATCACGAGCAGGCTCGCGCAGAGCAGAAAGAATGGGTTCCAG
AACAGTTGGCCGCGCGATGCGGTGTCGCTNNNNNNNNNNGCGTGAGCCGCTCCCGTTGCCGGAGTCATTTGTCTGGCTGCCCTGCTTCCTGGGAGTGCTG
CCATTGGTGTCGCCGGTGACTGATGACGTGTATTTTTCCTCATCATCGAATGGATCTGGGGTTCGTGGCGAAGCTTTTGTGCCGCTCGGTAGTGCTNNNN
NNNNNNNNNNNGATGGTGCTTCTCCAACAGTAGCAGACATGGAGGCTGGTGGCGAGATCGCGGCGGTGGTCGACTCGTCCNNNNNNNNNNTGCGCGGAAA
TCAGTGGCTTTGTTGCTTGTCCCGGTCGCAATCACCGCTTCATCATAATCTGGTCGTTCGTCCGTTGACNNNNNNNNNNGCTGCTTCGGAGCTTTGAGGT
TGAATGGGGAGACACGGGATCGCTGGCGTTGCAGCTTTGGTGTCATCGTCGGAGGTGGTTCCTGTTTGCGATAAAGTGGACGACGATGGTACTGCAAACG
AAGTAGTGACGAGAATGTTCGAGCTAGTCTTAGTGGTCTCGGTCGTGGCTTGATGAGATTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTC
GCAGTGACGATGTCGGTGCCACTGTGGGAGTCTTTGTGCTTGGTGTGGTTGCAGAGATCGGCTCAAGAGCATGCGTGGTCGAAATAGGAGACGGCGGTGT
TGGCGCTGGATCAGTGTTGCATGGGTGGAGAGTGTATGGTGTTCCTGCATCATCGCTGCCACGTGGGATGCATGCTGCAGATCCGTCGTCATGCGATGGT
CCATGTGACGTGCTCAGCCGCGAGATAGATAGCGGAGCGCTTGATGTATGAGAAGGTGACGGTGAGGGGGAATTTGATGGAGCGTGCGTGACGTTCGAGG
ACGGTGTGGCGGGCAGCCCGCCTGCTTCATTCGCAGCGGGTATGATATCTGGTGCGAAAGTTGCGGAGTTGGTGCTGTATGACGCTGCTGGTGATGGTGT
GCTGGCTGTTGCGGCCAGCGATTGCTCGGTGGGGACAGGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCACTTAATGGTGATTGACGACTCGTC
TTTTCCAGCGACTAGCGCCTTAAACGTTGTTGGGGATAACCTCAGGTCTCCCACGCCGCCACAGTCACCGTCAGGGCATCGACCCAGAACATGGACGAGT
ATCGTGGTCGCATTGGCTCGGCACTGCAGTCTACCCATATCCACACACGACACCTCCAGGCAGCTTCCACACGCATTTTCATCAAACAGCGCCGTGTTGA
TCACAGCATAGTGCTCTTTGAAGGATGGTCGCATGGGGCAGTTCCCAGCGCCAGACATGTCGTCATGTGTGTACAGCCGTCCGACCCCCGTGAGAGTGGT
TGCTTGTCTTTTCGGAAGCAAAACAGCGGCGATTGTCGTCCACACGATGCCGACACGCGGCCTTCGTCTCATGAGCGGCGAACGAGGCATGCGCGACCAC
ACAATGGAGTAAGATGACGACTGAGTCGCATACTCATCAGCGCTCTATCGTGAATCCTCAGACTCACAGCACTCTTAGTTGTAACGCCAGGCAGCAGCGA
AAGAAGAATAACTGCTTGTTTTTTTTTCTTTCGCAGCCGTTGACGCATTTTGTGGGGGAGTGTGTGTATTGTTCTCTGATTTCTTCCATCGATGCGTGCA
ATGGCGTGGGTCAGCGGATAAGAGCTCCACATGTGTCTACAGCTTCTCGCAGTATGCGTGTGGCAAATGGATGGGCGACTTGACGGATTGACATAGCAGC
ATCACCATTTTGAGTGAGCTTTTCCAAAAAGTGTCGGTTCAAGAGCAAGATGATGGAGGTTCAACATGCCACATGCAGAAAAAAATTGATTGTAGCTCTT
CGTTGGTGCGATCTTCCTGTGAGCTCCATGCATGTACCGATTGGTGCATGCAGAGTGCGTAGTGGCGCATTTGATGTGTGTGTGTGTGTGTGTGTGCACA
TGACGTTGAGAACGTTCGTGTTTGCCATCAGGCGACCTCCTGCTTCCCCATCCATCCATTCGCAATTTCCTCGGACCATGCTGACGCAGTGCTTGTGAAA
GGGTGCCACTGGCATATACGTCTGATTCATTTGCATATACAGAGGTCCGACAGTATCTTCCTGTCTGAGTCTGAGTCGAGGTATCTCACTGATATCG