Description :
From Genome Similarity Track
Location :
scaffold_1215:1448- 2891
Transcript NameFunction/comments
Pl_101046Major Facilitator Superfamily (MFS)

Sequence
1443 bases(100 bases per row)
AGGAACGCTCACTACGTCCAACGTGGATTGTGTACTCATCCGTCGCGATCTCCATGCTCGAAGCTTTCCACTACGGTTGGTCCAACTCGCAAGTCAACCT
CAGCACATTCAGCAATACGGAAGAGTGCAATGCTCGGCCTGTTGAGGAAGGCACATGCCTCATGTTTCCCGGTCACACCAAGACAACGTGGACACTCTTA
GTCAATGCGTGGATCGTCGGGGGTATGTTTGGTAGTCTACTTTCGGGATTTCCATCGAACAAGTGGGGTCGCCGCACAACACTGCGTTTTAACGCGATCA
TCATGGTATTGGGATCAGTTATTCAAGTAGTGGCGAACAACCCGACGTGGTTTGCAGCAGGTCGTTTCGTCACGGGTGTGGCAAATGGCGTGGCAATGGC
TGTGGTGAATACGTTCTTGAACGAAATCTCGACACCGCACAACCGCCATGCATTGGGCACGAACACACACTTAGCTGCTACGCTTGGTATCTTCGGTGTC
GCGGCAACATTCTGGTACTGGAACACGACGTCTGGTTTTCGGTGGATCGCTGGTATGCCGATCGTGTTTGCAGCTGGATTCGTGGTCTTGTCATTTTTCT
TTATGGTTGAAAGTCCTGTGTGGCTGGTTGCAAATGGGAAGGACGAAGAAGCTGAAAAGGAATTGGCACGGTTGTATGGCAAGGAAAATGTAAATGCCAT
GATGGGCTGGATCCAAGCCAACGACCGCCGATCCAAGCTGCCGTCGATGTTGAGTGGTGCGTCCGACAAGGTACACACCGAAACCAATTGGACTATCCTC
ACCAACAAGAAGTTCCGTAAACCGCTGATCATTGCACTGGGCTTGACCTGCATTAACCAGTTGGTGGGCATCAATGCTGTTTTCTTCTACTCGTCGTCGA
TTCTCAAGGATGCTGGAATTTCAGACTCTCGTGCCGGTCTAATGATCATCGATATTCTCAACGTCGTGCCCGTGCCTATCGCCGCCGCATTAACAAAGGT
CATGCGCAAGCGTACCATGTTGATCTCTGGTATCTTTGTGATGGTACTGTGTTGCATTGGTATGACCTTTTCGTTGGTCTACAGCGTTGGTTGGCTCTCG
ATTGTGTTCCTCGGCGTCTTCGTGGTTGGCTACGATTTGAGTATTGGTCCGCTACTTTGGCCGATCGTCGCAGAGCTTTTTGCGGATTCTGCTAGAGGTG
CTGCCGTCGGAATATGCATCACGATGAAGTGGATCTGCTCCCTCATCGTTGGCATTGGATTCCCGTACGTCGAGGAGGCAATCACAAACTACAGTTTCAC
GCCGTTCTTGGGCACCACCATCTTGTCTATTATCTTCATCTACTTCATGGTACCAGAGACGTCGGACATGACTATCGCTGAGATCCAAGATGGTTTCCGT
AGCAACCGCAGTGTGCAGTCGTCGAGTAAGAGTCAAATGTAGG