Description :
From Genome Similarity Track
Location :
Scaffold_1848:1448- 2490
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1848-snap-gene-0.1Folate-Biopterin Transporter (FBT) family

Sequence
1042 bases(100 bases per row)
TGGGCGCCAGCGACGCGCAGCTGAGCACCATCGCGGTCGTGCGGTCGCTTCCCTGGACCTTCAAAGTGCTCTTTGGCATCTTCCCGGACAGCTTCCCCAT
CTACGGGTTGCGTTTCAAGCCCTACCTGCTGCTCGGATGCCTCACGAGCGCGTTCTTCCACCTGCTGCTGGGCGTGTATAGCGACTTGCTCTCGGTGCCG
GGGTTCGCGCTGCTGCTGCTGGGCGCCATGGTAGGCATCGTCATGGCCGACGTCATGAGCGACGCGCTCGTCGCGAACCGCGTGCTGCGCCAGCTCGAGC
TCTATCCTGGCCACGTGCAATCGGCCGTGTATATGTGTCGTTTCGTGAGCGAGATGGTGGGCTTCTGGGTCGGCGCGCTGGTGTCCAACGGCAGCTACTG
GGGGGTCGGTCTCTCCATGAGACAGCTCTTTGGGCTGCTGGCCATTGTGCCGCTGCTGACGGTCATCCCGTGCATCTGGCTCATGCACGAGCCACGCGTG
ACGCCCACCAGCGTCATGTCCATCAAGACGCAGCTCGCACAGCTCTACGTGATGCTGCAACGGCGCGCGACGTGGCAGCCCGTGAGCTTCCTGGCGTTCT
TCAACGCCTTGCTCGTGCACAACTCGGCCTGGGGCAACTACCTCAAGGTCGCGTTCCGCTTTGACGCATTCCAGTACGGCGCACTGTCGGCGGTCGGTGC
GAGCGTGACCTTCACTGCAATTCTCGTCTATCGCTATTGCATCATGGGCAAGATCGAGAGTCCGTGGCAGTCGCTGTACTTCGTCACGGGCCTCGTCGTC
GCCGCCTTCTCGCTGCTCAACGTGCTGCTCGTGCTCAAGGTCAACGAGACGCTGGGCATCGCGCCTTTTTGGTTCGCAGTGGGCGACACGGCGGTCGTGG
CCTTCGCCAAGGGCTTTCAGTACCTCCCACTGGCCGTCATTTTCGTGAGCGTGTGTCCGGAGGACCAGGAGGGCGTGGCCTTTGCGCTGCTCACGGGCAT
GACCAATGTCGCCCACGCGTTCGCCAACACGGTCTCCAATAT