Description :
From Genome Similarity Track
Location :
Scaffold_364:14471- 16898
Transcript NameFunction/comments
g6699.t1hypothetical protein

Sequence
2427 bases(100 bases per row)
GCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTGAAAGTCGCTGGGGCATTTGATAGGCCCTGTGGCATCACTAGCCACTCCCAGAGCATGCCGC
TCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAAAGCTCGCAGCCCGC
CATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGTCTGGGCGAGCACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACTTCCCG
TTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGAGACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAATGACCT
CGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACACAGTACTTTGTGCCTGGCACAAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGAGTTG
GGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTTCACCAAAGGATACACTGGATCCTTGGGGTTCTCGAGGATCGCAGAGCCCGTGCGCGTTGCG
CGCTTCTTGCCAAGCTCGTCCAGGACATCCTTGTCCATAACGGAAGAGGAGCTCAGCTCTTCTGGAGAGGCCTCCGGCTTCAGGAGCACCATCTCCGCGA
TTGCCTCGGCTTTCAGTTGTGCCAGGAAATCGTCCATCGACATTTCCTCGAGGTTCAGTAGCTCTGACACCTCAGGCAGGGCTGCCAACGTTGTGGAGCC
CACCTTGACCGTACACCCGGTCTCGCCGTCGAAGAAGTGATAGCATTCTTCGGCCGGCCGTGCCTGAGGAGAGTTCTCTCTCTCCGAGTCGCTTGTAGCG
ACTCCAGTCTGTCTCACCAGACTCGGCTTACGGCGGCGACGACGTCGTCGATGCCCACCACGGCATGGTCCTTTGTTACCCACAGCCGGTGGTGACTCCA
GGGTGGAGTCGGGAGTTCCATCGACTCCGTGTGGCACATTGTTACCCACACCAGAGGTGCTCCCAGCAACCTCGACCCTGGCCACGGTCTCGACCTCCTT
GGTCTCACGTGGGCTCGTTTCCCTTGGGGAGTTGACTTTCCCCGGCGTCGATAAGGCCGAAGGCCGTACGGTGCCATAGTCAGGAGCGGTGGGTACTGCT
GGCATTGCAGTTCCCCTCGCTGGACTCGACGTCCTGTCCACCGGCATTGCCTGTGGCGGTCCGTTGCCCGCGGTGGACGGTGTCATGGCACCTGTTGCGG
CTCCTGCCGTAACTATTTCTTCGGAGTCATTTCCGACTCGGCTCCGGTGGTAGGCCCGGCTGCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTC
AGTAGCAGCAGGCCGGCTAGCCCCGATGGCTTTGCCGCGCCAGTCTATCCAGGGCTCATGCTTCTCAAGCCATGGCATGCCCAGGATCAAGTCGTACTTG
TCCATATCAAGAACGAGGAATCGTTCAGTGGAATTAAAGTCCTCAAACTTGACGGACAGGTCCATAAAGACCTTGGGCACCTCCACTACAGTCCCGTCAG
CCAGTCTGACTAGGACATGCCCGTTCCCTTTGCTTTCTCGTAAAGCATCGGTGAACTGGTCGCTCTTGCGAGCGACCGTCCGGCGGCGTGCAAAGTTCTT
TGACGCCCCAGAATCGATCAAGATTCTCATGGGATGGTCGTATCCCCGTACACTTGCATGTACTACAAGCATCCCTCCGCTGCCCTTCTCCGCTTCGAGA
GTACAGAGACTCTCAGGGGCTAAGCCTTCATGGTGCGCACCACCCGCGCACCACTCATGAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTG
GTTCCCTGCGTTCCCCTGGCCACGGGGTCGCGGCTTTTGCCAGCGACCCCTAGGACCAAAGGGCTTGGGAGGAAACCGCCGTGTTGTTCCTCCCGCGGGG
CACGCACGTTTCATGTGCCCCAGTTTGCCACAGCCGAAACAGCGAATGTCGTGCTGTTCGGCAAGGCTCAGGTCCATCGGCACAGGACCGTTGAAGGGGC
CTCTACTTTGGGGCCCGCCCTGAGTGGAGCCCCCAAGCCACGCAGTGGCAGGAGTGCGAGCCTGTCGATGGCTGTACTCCTCCTGAAGAGCGATTTGAAT
CGCTTCTTCCAGGGTGCTTGCTTGCACCCGAAACAGCTGCGTGCGCGCTGGGCCTACTCGCAGGCCGTCCATGAACACCGTCACCTTGATGTGTTCATGG
AGTGGGTTTCCCACCAGAGATGCGGTGAGCTCCCTCATCTCCTGGATGTACTCGTGCAGCTCACGTCTCCCTTGCTTGCACGCAAGGAAGCGTGAGCGCT
GGCGATACTCGTAGTTCGCCGGGAGGA