Description :
From Genome Similarity Track
Location :
Scaffold_653:1447- 2460
Transcript NameFunction/comments
Pytve_DAOMBR484snap-pve_contig_653-abinit-gene-0.18MAP kinase

Sequence
1013 bases(100 bases per row)
ACGTACTACGAGTACGTCAAGACGATCGGCTCTGGCGCCTACGGGGTCGTCATCTCGGCCAAGAACGCGCAGAGCGGCACGACGGTGGCCATCAAGAACA
TCCAGCGCGCCTTCGACGACCTCACGGACGCCAAGCGGATCGTGCGCGAGATCAAGCTCATGCGCCACCTGCACCACAAGTGCGTGCTGGGCGTGACCGA
CATCCTCGAGCCCGTGTCGCTCGCCAAGTTCGAGGACGTGTACATTTGCTCGGAGCTGATGGCGACCGACCTGCACCGCGTCATCTACTCGCGGCACGCG
CTCTCGGACGAGCACATCGCGTTCTTCATGTACCAGATGCTGTGCGCCATGAAGTACGTGCACTCGGCCAACGTCATCCACCGCGACCTCAAGCCGTCCA
ACATCCTCGTCAACGCCAACTGCGAGCTCAAGATCTGCGACTTTGGGCTCGCGCGCGGCGTCTTCCCCGAGGAGGAGCTCGAGCTGACCGAGTACGTCGT
CACGCGCTGGTACCGCGCGCCAGAGATCATGCTCGGCTGCATGAAGTACACGCGCGAGGTGGACGTGTGGTCCATGGGGTGCATCTTCGCCGAGATGATG
TCGCGCAAGCCGCTCTTCCCGGGCCAGGACTACATTGACCAGCTGCACCTCATCATGAACACGCTCGGTGCGCCGAGCGAGCAGGAGCTCTACTTCCTCA
CGAACGCGCGCGCCAAGAAGTTTATGAACACGGAGTTCCACAAGCGCGGGCCGAACCCGACCAAGCCGCTGTCGCAGATGTTCGGCGAGACGGCCCCCGA
CGCGCTCGACCTGCTCGAGAAGATGCTCGTGATCGACCCGAACAAGCGCATCAGCGTCGATGACGCGCTGGCGCACCCGTACCTAGCGTCGATCCGGAAC
CCGGAGGACGAGACGGTCGCGGCCTCGAGCTTCGTGTTCGACTTTGAGAACGAGAAGCTCACCAAGCCCGTACTGCAGAAGCTCATCTGGGACGAGATGA
CGGCGTTCCACCC