Description :
From Genome Similarity Track
Location :
Scaffold_258:14467- 20475
Transcript NameFunction/comments
Phypl_g6070hypothetical protein PHYSODRAFT_552991
Phypl_g6071conserved hypothetical protein

Sequence
6008 bases(100 bases per row)
GATGGCGGCCGTCATCGAGCGCATCGTGGACCGCaagctcatcaagcagcgcgtgcactACTTCGTGGTCTGGAAGGGCTTCGGAGAGGAGAACAACACG
TGGTGAGCGAGCGCCACCTCCCCACGTACACCAAAATTTCTCCTCTCGTCACTAAATTCTTCTCTCGTGTGTATTATTTAATATTATTTAACGACGCAGG
GAAAGCCGCATCGACTTGATGGCCGACGGCTACTCGGACGTCGTCAAGCGCTTCGAAGAGCGTGCGTCTCGAGCTCTGGACAGAGAGCGACCAACTGTGT
CATCGTTCTCATCACTAAAACTACATTCTTTTTATTTATTTATTACTGTGCAGGACGCAAGAAGGAGTCGGGAGGATCGACGCCTCGCGGTCGCAGCCCC
GGACGCTCGACGTCCAAGAGCCCgcgcaagagcaagagccCCGGGCGCAGCCCTGGCCGTCCGAGGGGAcgtcgcagtcgctcgcgcagcgtctcggtGA
GCCGCAAGGTGCCGgtgagcagcaacaacgacgaagacgagaagaagaaggaggaggaggagtgCGCCGTCAAGGCCACGACCCCGCGGCGACGCAAGAG
CCCGAGCAACAACGAGAACAATGACGGGGCCAACGGGAAGGAGACGCCCAGACGCCGATCCACGCGGAAACATGCAACGACGGAGACCGCATCCTCGACG
CATTTTGTGTCTCGtctggacgagcagaaggcggaccccgccacggacgaggaggacgactcgttgctgctgcggtcgacCATGGTGGCGCTGACCCCGC
AGGTGCGAGAAATGGCTACGTCTTCCCCCTTGGCGGCAGAGATGGATGTGCACAAGAAGCCAATGACGCTGTCgtacgaggaggaagaggagtcggtgct
gctgaagccgCAGAGCATCAAGGTCCCTGCCACTTCAGGATCCAGCGCTACTGTTAGCCCCGTTCACGAGCACGCTAGCCCTGCACAGGACGGCTTGATC
GCCAAGCTGGTGGAAAACGGCTACCTTGCGTCCTTCTTGAGTGTAGCAGCGGTAGTGGGATCTCTAGTGGCGAGCCAGATGCTGCCGCGTGATGCTGAGG
ACGGTAGCGACCTGTGGCGGAGGTGGCTGTCGTTCCTCACCCCTGTtgtagcgctgctgcttttctTCCACCAAAAGGATGCTCGCGCGTCGGCAAAGTG
GGTGGCCACTGGTCTGGCgtggcgtgctgctgcagagctgtTGCTCTTGATCGGTGCCACTCCGCGTGAATTTGAGACGATGGTTGCTGGCTCGGCCGTT
TTCGCTAACCTGTCGCTGCTCATTGCGCTCGTGTCCATTCTTCGCAacggcgagcacgagcagtcCAAGTCTACGCTTGGTCTTCTGACGGTGGGCGTCT
TGACCCTCTTCCTTTCCGACAGGTAAGCTGTTGTATGGATACATTGTGATGTACCTTTGTTGTGAGGGCTAACTTGATCTACTTGTTGTGTGTTGCTCAG
CTGGGTGATCTCCACGGAGGACTCGGAGCTGGAGTCGCGTGTTATCCTCATGTCGACGGCTGTTGTAAGTATCACTTCAAACTTAATTTTCACTACTGCA
GTAATTGTACGACTAACTTTGTACTACTATACCCCATGGACGAATTCCCCAGCTGACAATCGCACTGTCGCCCATGGCGACGGTATCCTTCGAGGATGAT
GATTAGGATAGGGCGCCTCAGTCACCCGCGACGCTGTAATTAGGAGTTTCTTGTGTTTTTCGCTGACTTCATTCGGAGGCAGCGTTGTCGCTGCTATATG
AATTTTATGATCTCTGCTGCAGACTGTGTTACTAGAACTCGTTATCTTCAAGAGCTTGGGAAGAGAAGcatactactagtagtaggATTCTGTATTTTCA
ACCGACCCTCAAGTACTTACAGGTAGATTACTCTAACGACAGTGCCAGAtgcagcgtcttgatcaGCAATTGCTGGCTCTGGACGCTCACGACGGAGTCG
ACATCGCCCTCGCTGTGCACCAGCTCCCGAATGACCTCAACCGTCAGTGCTGCCGTAGTGTGAGCGCCATGCACCCGGTGCTCGGATCGCGACGAATACT
CTTTCATTACCTTGAAGAGCATCGTTTGACGCATCAGCGACTCCAGTTTCTCCTCGTTTACACCCGCGGCCGACTCGGCAGCCAGGTTATCCCACAGCTC
ACCGTCATCGAGAATGCAGGATCGCCATACACTAGCACGCATCTCTTCGTACTCCTCGGTCAGCGGGTCAGCCGCTAGTGTCTCCAATGCTTCGAGCGCC
ATCAAGAAAATGTTGGCTCTGTAGCGCATGACAAGATATTCGTGAGTACAGTGTCGCCCATGATAAAACCCTCAAGCTTGACACGTTACCTCATGGGGTC
ATCTTTGTCGGCGGAAAGAGCTGACGACAAGCAGGCGTGGACCAACTCTTCCGGTGAAAGCGGCTGTGGGTTGATTGGCTCCTTCAACggcaactggagc
agcaactccTGAAGCTTCCCTCGTTCAAGCTGCGCCATACAACACAAAGAAATCGTAAATACCCCACGCGGCACCAACACTACGAACAGCTCAACGTACC
TCATGGTTGACCTCCTGAACCCTCTCGGGGTGAGACAGACTGGGGGAAGCAAAGGCAGCGATCTTGGCAATGCTAGCCATCGTTTTGCGCTTCGGCAACG
ATCGCGTCTCTCCCTTAGCCTCTCGCAGCGCAAGTGTCGCCACCTGGTCATACCGCTCGATGGAGACTGCAGTTAGCCAGCGGTACTTCCTCAGGTGCTC
ACGGCTCTTCATGAACTTGTGCAGTGACGGCGAAAAAATTTGCGAGTGGGCCAGCAGGTATGCAATCATTGTCGCACTAGCCTCTTGGTTGCCTTGTGAC
CACGGGTTCCGAACCTCGCCGTTGTACCAGCGGAAAATAAAGTTGTCGAAGCCCTCGTGCTTCTTGCAGTACAACTCCAACCTCTTCGACGCGGGGCTCT
TAGGAAGTTTGCCAAGGACACAATCTAGCTTGGACAGATTGACTGAGTCTTCGACGAACACCAGGAAGACCATGCCCTCGAAGTACGAGTACTTTTCGCA
AAGCACAACGCATCGGCTGAATAACTCTGCCCGCTTCCGCGTGACAATGCCATCCTGGTCAAAGTCAGCTACAATGGCACTTTCTTGAGATGATTTCTGT
GTCGCGATGTACACAAGGGGGTTCAGCGTTACGCACTTGGTAAAGGTTtcctccttgcgcagctcatCTGCTTCCTCGCTCGAAGCAAGAGGAATAAATC
GAGCGTAATCGTCAAGCAGGACCGTTCCTAGTCTCTGGATCTGATCCGTGAGCTCGAACACCTCATCATATTGCCAGCGAATGTGTTTGTCGGTGGGCCC
CTGTGAATATCCAGCAAGAACAGACAGCCTCGAGATTTGGGTCGCCAGAACTTCTCGCACTTCACGTGTAAATGCCCAACTTCCTGTCGGAGTGAAGCTG
GCAGTAGAGCTTTGCACAGGTGTGCAGAGCATACTGAGCATGGCACAGCCACTCTCTAGCAGAGCGTAAAGATATGTCGGGTCACTCTCGCCAATAGAGG
TTGCCAGGATCTGCACTTCGTCGCCCAAAAGCTGGAAAAGTTCTGCAATCTTGCTCACTTCGCAGTAGAAAACATCAAAAGAGTTGTAACCCgcgaggcg
aagctgctccttctgATAACCACGCTTCTCCACGGTCTTCTCAAtcgcgtggagaaggaaTTTTCCGGTTAATCGGCGTTGGATCTTTTGAACATCCGGC
GAGGCCTCGTCCTCTGCAGAAGTTGAAGACAGAATCGAAGCCTGAAACTTGCTGAGAGCAATGACAGCTTGCAACTTCTCCTCGTTCTCTGTCAAatggc
gcttgagctccgctGAGTTTTCAATAAACTCCCAAACGGATGCAcagcgtcgctgcaggaACTCCATGAAAGCCGCGTGGCGATTCCTCTTTTCTACTAA
CTGGTAGCGCACCAGCTTGGGAGTGACCGAAGAAATGTCAGCCTCGCTCTTCTGAACATCGTTCAGCGGTGGCGCTTCGTCATTTCCTTCCTTCTCCCAG
CGCAGCCCAGACGAGGACTTAGCATCCAGAATCTGGAAATCCACAGATACAGCAGCCTGGGCAACAGATCCCACGTCCCTCGCGCTCACACGCAGCGCGG
ATGCGGAGTTCGGGTCATCGTGAAAGTGCGTCAAAATCAAGCCAACGTAGTCCTCCACACTCAGGTTTTCGCCCAAAAAGTGAGACGATTCGCTCGAGTA
ATAGCTTGCTTCTTCGCGTCTCCGGCGTGTCCTCTCCACAGATGCTTCGGATGGAACTGGAGCCGCCAAACGTTCCAGCTTTTGCATATCAGAAGCCGTA
GCTACACACACCGATCCGCTCGGCGACTTCACATCCTCGTTAATCAGCAAAAACGACACCGATCCCTTCACAGCGTTGTTGTCAAAGGAGCTCTGGTCAA
TGCGAGCTCCAAACGCCAGAGCCAGTCGGCCCTGAGCACCTTGAAGCGGGAACGCAGCCGAACGCACACTAGTCTGTCCAGCTTGTGGTAGAAGAATGGT
AGAGAACTGAATCGGCTGCATCTGCGTCCATACGAGGTACAGGGCACCCCGGGTGATCGCAAAACTCTCGACTTCAAAGAATCGGTTAGCAGCCTGTTCA
TCGAAGGCCGGCTCAAAGTCCAGCACACATGCCCACTCCAGCTGAGGAGGAGCGTCGTCATCCACGGCTCCGAGTGAAAATTGGAACAGCGCGTACTTGA
CCTTAGCATTGGTGCCAGCacgcgacgaggagcagacAAATGCCACTAACAGGGCGAAGCACGTTTCCTGCACGTACGGCATCGAGACGACGTACACCTT
CGCCAGATGCGTATCCAAGAAGTTGTCACTGAAGTAGCTGATAGCCACACGGCTCGCGTCAAAATGCCACTGCGAAACACACGAGCAGTCCATCACGTCC
CCCGTGCTAAACGTGCGTCGCTCCAGCATGCTGTCCTGGAACAGCACCAACATGTCGGAcgtctcgtccacctccCCACCGCTGCTACTCATCGATGCCG
CATCTCCCATGGACGAGGGCAGCACTCTCAAGTACTTGATCGGCTGGTTGACATCCAGCTCTCCTCCATCCGCTCCAGATctcgaggccgtcgaggAGAA
GAAAAACTGCGACACCGACTTGGTGATCCCCGACAGGAAGCCGGCACTCTGCTTCTCGAAAGCCCGGACTCGAATACGTCGgtcctccacggccacctCC
CACACGTTGCCTTGGTTGCTCCAGCACACGAGTCCCGTCGCATCGTCTTGGATCTCTTCGTCCTGCGCGCCTTCTTGGGTCGCCGCCATGGCTGCGTTCG
GGTGCGTCCTCACTTCTTCATGAGCCCCAAGAGGGATCTGCACACTGAGAGGCACGCTCTCATAGGGGAGTTCGATATCCTCCCAGAAGAGCACGATGCC
GCTCTTGCCCACGATCATGAGGCTGAGACTCTGGCTGTAGAGCGCGAAGAGAAACGGGTACAGCACTTCATcgggctccagctcgtccggcAGCTGCAGG
GCGATCACCTTGCCCCTGTCCTGTtgccacagcagcaccttggacCGGAGCGGGAAGACCAAGTACGGGACCCATTGACGGCCGCTGCGATGACGCGCCG
AGGGCACCGACGCCCGACAGCAGCGAACCTGATGACGCTGATGCACCGGCAGCTGCGGCCACTCCTTACGCACCTCTTCCAGCACGTGGGGCGGTAGACT
GGCGCCCTCCACGatggtgcagctgcgcgtgtccgccagcagcgacgcgctctCCTCGACGTCGGCCTCGCTGCCCGAGCGCGGCGCGTACAGCGCGTTC
CAGTgctccaggcgctggcgcttgctggcgcccagcgcgtcgggcgacagcagccCCGTGCCCACGCGCTTGGACGGCACCTCGACGAACTTGCGGGCGC
GGAACATG