Description :
From Genome Similarity Track
Location :
Scaffold_14:144669- 148793
Sequence
4124 bases(100 bases per row)
CTGATTGCTAGTGGCAACGCACTGCCGCCGCCAGCCTATGGCGCGGTATGCGATATCGACACACAGGAGCACGCCCCAATTAAACAGCGTGCCCGGCGCG
TGCCGCTACGATTTCACGGCAAACTGTACGAGCTGCTGCGCGCTCTGTTGCGAGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCCGATCGT
GATTGTGATGAAAAAGGACGGGCTGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAGTATGCAATGCCGCTAGTC
GACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGAGCGGTCATGATGATCTTGCGAGCACGTAAAG
TATCGGCGTTCGTCTGCGCACTCGGACATTTTGAGTGGTTACGCATGCCCTTCAGGTTAAAGAACGCGCCGATGATCTACCAGCGTATGATTGACAACGC
ACTTTGGGGGTTCGTTCAACCTAACGGAGGTTGGTTTGAATACTCGGAGAAGATACGTTTAGCTGAAGAACAAGCCAAGGAACGTCGTGGGCCAAGCGCC
GAGGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGTGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTA
CGAACGGGGAATCAGACAAATCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGATATTTACTTCGGTGGCGAGGATTTCGACAGCTGCCT
GGCGACGCTGGACCGATTGCTGGCAAAATTTGCACAGTGTCGGATAAGCATTAGCTTTACCAAGAGCATCTTCTGCCAACCCAAGGTGGACTTTCTGTCG
CATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCATTGAGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCAGTCGTTTC
TTGGAGCGGTTAATTACTACAGTCGCTTCATTCAAGACTTCGCGGTCTACGGGGCGGCGCTGTACCAGCTCAAGGATGAAGACTTTGCCGTTGAAGGTAG
CACGTCGTTCCTTCGAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGCAGTTCACGTCATGCTCTTTGCGAA
TGAATGGGCGTTGAGCACTACGCTAATGCAATAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGAGTGCTCAAGGAGACCGAGATGAACTAC
CATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGA
CGTTAGCGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTAACGCAGTGACACCTGAAGGTGCAGCGCGTGAAGGA
GAAGGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCGCTCGCGCCGGTGGCACCTCCAAACAAGGGTTCC
CCGACTATTCGAATGGACCCCACGTTGCTGTACGCCAAGCTTTCCCGTAATTACAGCGGATTCGGCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGT
ACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAATGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGA
GGCAGAGTACAAAGGGATGATTAGCGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGCTGGTGACTCAAGGCTCGCGATTCAACAA
TCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCGATCAGTTAAATATCTTCACA
TTTTACGAGAATACAACGCTGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTCATCTTGGCTGAAACTCGCAAGTCGGAATT
GGCATCGCTGAATCGCATCCAGGAAATGATCTACGAACCGGATGAAGACTCGGTAGATATTTCGTCACGTGGAGCAGAGCGTCAAGTACATGTACTGTCA
GGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATCATGGTAATATGGCAGTGATGACTCGGCGAC
AGACGAAAGCTAAGAAACGCGTCAGGTTTACTCGGAGGAGGTCTCGAAAGCTCAAGAACAGCATGAAGAACGACGAGAGACGTCCACCGAAGATTCATTC
GGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCAGCGGCTTTTTCCGATGCGGAAGATGTTGACCCGGTAGCGATACAGCGGGAGCGACGCAGAC
GGATACTGGTGGCACAAGATGAGGAGCAGAAGTGGTTTAACATCAAGAAGGTGCTCCAGGGCCAAGCACAAGAGCTGAGTTACAGAGAAGCTCGAGATGC
CTGGAAGTACTCTGACCGGTTCGTGCTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGGCGGTACGACCACGGTTGGCAAGAGGAGATCAAG
CTGCGGCTTGTGGTACCGACAACGACGATTCAAGAGGTCCTGCAGAACTGTCACGACTCGCTCGAAGGAGGGCATCAAGGTGTGGTGAGAACGTTCCATC
GCGTTAAGTCCGATTATTATTGGATCGGCTTGTACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCGCAGCT
TCGTGGAGACTCACCTGGCAACGTACTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGTAGGGGCAACACG
GCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACCGAGTGTTGCCCAAGTGTTTGAAGAATGTG
TGTACCGACGGTTCGGGGCCCCATCATTAATAAGGCATGACCGCGACCCACGCTTCATGAGCGAGGTTTTCCAGGCATTTGCAGAGATGATGCAATCAAG
ATCACGAGCGACTTTGAGCTATCGGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCGGTGATGGGGTCCGTACGGGTGTACGCGGAAGCCCTC
TACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACAAGGAAGGAAACACCGTTCTACCTCGTTCATGG
TTGGGATGCGCAGTCGACGTTGAGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCAGACGCACTGGCGTGGCGGCGTGAGATCAATCGA
CAACATGAGGTCGCCCTCACTATGGCAAAAGATTATCAGGCTGTAGAAAAGGAGCGACGGGCTAAAAACATAATGATACCCTGAGTCGACTGGAAAAAGC
CGCTGTACCTCAACAAGGTGGAAACGAACACTCGGCGGACCCTCCAGAAGCTTTGGAAGAGATGGAAGATCCTACAAGAGTCCCACCGAGATCTCTTTTT
GAGATTGGGAGCCAGGCGTGGCTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCACCGATGGCATGGACCTTTTCGGATCAAGCGCA
AGGTGGAAGCGTTTGCGTACGAGCTGGAACTGCCTGATCGAAGTGGGTATCGCTTTTACCCAGTAGTGCATGTGTCGAGACTCAAGGCTGTCAACGAATT
CAACAGTCGACCGAGCACTCGGTTGGTACTAGACGCGACTAATGAAATAAGACTCGACTTCGATGAGGAACTACTGCCTGAAGACAGCTGGGAACCGGAT
CAAGTTGCCGGTGAATATGAGGTCGAGGCCATCCTCGACGACAGAACACCCCTGTCGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGG
TGAGCTATGAAGATACAACTTGGG