Description :
From Genome Similarity Track
Location :
Scaffold_78:144663- 146103
Sequence
1440 bases(100 bases per row)
CTAACGGTGCAGGCATTGCGAAAGAAGCACGGGCACAAGAAACCACCAAATAGGATCGATAAAGAGTCTGCCGAAAATCAACAAGTTGGCCATCCAGCTC
GTGAGTATGACGATGATCCAGCTGCATGTGAACTGTGGGGGTTTCCGGTAAAGTATTCTCCAAAGAAGCAACTAGAAGCGCAATGGCGTGCAATAGGTGA
ACAAAATCAACATGCATTGCGCGTCAAGCCAGAGCAGGCTACTCGACAGGAAGATACAGCTACCCGTTCGCACCAAGAATCCAAGAGAAATGAAGCCGAC
TACGCACGATATTTGTACTTGGCCAGTTTGTATGGGCCCCTAGACGCACTATTGTATTGCTGCTGTCAGCCAGGATCACATGGACGTGTATACATGCTTC
TTGTTGATATCTGCGCTCGTCGAATACAACGTTGGGCCCCCCAGAGAGTTTCTGCGCTGCGACGCTACTGGATTGGCTATTTGGCTCGCGAAATCGCTAC
AACCAGTATTACTGAAGGGTTAGAAACCATCGTACACAGTTTTCAGCAGGAACGCCAAGCGAGTGCATTGTTCCTGCGCTTGAAACTACTTCGTGCAGCT
CGAGCTTTTCGCGCCTGGTGTGATTATTCATCGCGGATGATTCGACTTCGTGATAAAATGCGCTTGGCTCTTACAAAAGATCTCGAATCTCGTTTCTACC
GGTGGCGATACAATGTAAAGACCCGCAAAGGGTTCAAAACGCAACTTAAACGCATAGCTAAGCGCAAAGCGATGCAAAACGCGTTTGTGCAGTGGCAATG
CTGGCGCTCCCAGCACGAAAAATTACGCCGTCATTTGGCACAGCGGCGGCTGCAAACGAAACGTGAAAGCTGGCAAATGTGGAATGGATTTGCGCGTTGC
AACCGCGCGGCAAGAAGACTACAACGCTTGTGGAGAGTTTACTCTTGGCGAAAACAGCGATACACCAGTGTCAGAACGATTCAGAGAGTATATCGTGGTT
GGCGAGGAAGACACAAAATGAAGCAGCTTCGCGATAAAATGGCTATTCACAGTGTGCTGCTTCGAGTTACAGACGTCGCAGCTTGGGAGGTGCGATGTGC
GGTACTGACCAAGCAGAGGAGACTGCTACTGGAACGTGACCTTATTCGTGCTCGACAACAAGCTGAATATGTTGTTCAAGCGGAGAAGCAAGCTGCAGTA
CTCGTAGAACCCGAATTGTCGAAAGCGGTTCGTAACGCCATGCACCGGAAACTAGATAAACATCTTCAGCTTCTGAGAGAAAATGATACAGAGGTACCTA
CCCAACTCGTAAAAACGAGTAGCTATCTCCGTCGAGTAGCAGTTCAAAACGTTATTGACGATGAGCGAGCATCGGCGAGGCAGGAAGCTATTGAGGCATT
TCGTGTTACCAACGGCCAGCACGGTGACGCGAAAGCAAAC