Description :
From Genome Similarity Track
Location :
contig_40:14464- 20383
Transcript NameFunction/comments
g8603.t1hypothetical protein
g8604.t1RAW26666.1 Transposon Tf2-6 polyprotein [Phytophthora cactorum
g8605.t1XP_008909821.1 hypothetical protein PPTG_14641 [Phytophthora parasitica INRA-310
g8606.t1hypothetical protein

Sequence
5919 bases(100 bases per row)
GAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAGCACTTCGTCGTCCGTTCAACGCCC
AAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGGAAGCACTCCACCGCCTGGCAGCGG
TGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGTTCTTAACGCGTGAGCTCGCTGATCT
ACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGCGGCGAAGGCAAGACCCGCCTTCAC
CTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCTTCCTGCTTTCCAAGTTGTCCGGGA
AGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGACCTGCGACTCGCGTTCGAGCCGCC
CCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAACGCGCGCGCCATCTCGCCTCGTGT
ATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCTTCTACTTGACCCGCAAGACGCCAT
CGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTCACGGCCTCTTGTCCCTGACCCAGA
GCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCCTCCACTCGGGGGTCGCGTCCTATG
AAGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTACGACTGCGAACGACGTCGCCGCTC
CAAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAACCTCCTCCTAGCCCTCCCGTGCTT
CACGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCACAGCGCCCAATACGCGCCCTGCTGG
ATTCCGGCGCGACGAACAACTTCGTTCGCGCCGCGAGTTTGTCGGCATTGCCGGCGGACATGAGCATCCGCGAGAGCGGCGGTGAGATGATCGTAAAGTA
TGCTGACGGGAAGCCGCGGCGTACGCCACGGCGATCTGCCACCTTCGCGTACGAGTTTGACGGGTTCCGCGGCTCGGAGGAGTTCTTGGTGATCGAGCTG
AGTGGCTCCTTCGACTGCGTCTTCGGAATCCCGTGGCTCGCTCGCCACCAGCCTGCCATCGATTGGCTCGCTGGTACAGTCCGCCCCCGCGATATCGACG
TGAATGCCGTCGAAGCGTTCCTGTGCGGAACGCCAAACCAATGGCCGCATGTTACAGTCATGGACCCCGAATCCATGGCCCATGCTGCACCCGAAGCGAG
CGATGGCCCTTCATGTGCCGTATGCGAATACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCGTCCGACGTGGTCGAGCATGGGTTCCCACGT
CCCGATGAGCAGTGGTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCTCTCCCCCGAAGAAGAAGATG
ACGTGGTCGAGCATGGGTTCCCACGTCCGAGTGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTCCCGCGGGTGGTCGAGCGAGA
GCTCCCCGAAGAAGTTGACGCGGCCGAACACTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTGCTGACGTGATCGAGCATGGGT
TCTCACTGTCAGCTGTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCCGTCGCGGGATCCAGTCGAAGC
TGAGACCGAGATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCATGCGACGCTGCCGAG
ATCACTCGACTGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCGCCGAAGACGCCGCAT
CCATCGCAGCCGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAACGCCCGCGCAGCACGATACGC
TGCCCAGTCGTTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTT
CCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGA
TCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGG
ATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGC
AGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAA
TGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGC
GCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTG
ATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTG
CTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTA
CTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTTGACGCG
GTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCG
CCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGA
GCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCG
ACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCC
TCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAG
GTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGATGATCAAGTACTTGG
GAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTGCTGACATACAGCGTCGA
TCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGCTCCCAGCGGCGGCCACCTCGGA
CGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGCTCCTGCGAAGCGTGCCAACGAG
TCAAGCCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGGACTTTGTCTTCGGGCTGCCTCG
AGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGTCACCATCACCGCGGCGCAGTCC
GCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCTCCGATCGCGATCCCCGCTTCACCGCCGCATTCTGGACCGAGC
TCTTCAAGCTAGTGGGGACGCGGTTGAAGATGTCCACCGCGTCACACCCAGAGACGGACGGCCAGACCGAACGCGCAAACAGGGTCGTCGAGGACGTGCT
GAGAAGCTTCGCCACGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTCTCAACAACGCCGTTCACACGTCGACCGGTCTCACGCCA
TTTTACGTCAACTACGGTCGCCATCCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATTCCCCAAGGCGGCGCTGACGACGAGAACGACTCGGCGC
ACCTTTCCAATGCCGACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCTTGATGAACGGTGTCACGACTCGGCACGGTGCCCGAGC
CTCAACTCGAGGCATGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCATCTTGGACACGTCGGACGCTGATCAACCCACGTCAGCGTCCT
CGTGCAATTGCATATGAAGACACGTCCGGCGCGGCGACCCCGCCCGCGCCGCCTCCAGCAAACTTTGACCCCATTCCGTCCCCACAACCGCGCGACACAG
CGGCTGTCAGCAAGTTCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTGCAGTGGCAGTCGATCGTCAGAAGGAAAACGCTGATCG
ACGCGGCCGCAAGAACATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGGCATTCAACCCATTTTGGTTACCAATTTGGGCGCGAAC
AAGCTCGCGCCAAGGTATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACGCTACAGCTACCTACAGCGCTCCGGCTTCATCCTACTT
TCTACGTCGGTCGGCTGCGGCGATACCATCCCGCGCTTATCCCCAGCGACGACGCTGCCACTCCCCAGCGTTCCGGTCTTGGCCCCGCTGCGGCGATTGG
CGCCGCGGCACTCGGCGACGCAGCTCCTGGTTCTCATTCTCCAGCACGTCCAGACGACGCGCCATCCGATCCAGACGCTGCGCGATCGCAGCGTCCTGTC
CGCGATTCTCCGTTTGAGCGGGACGGCCCCGCTCCTCTCGTCGATGGTGCTGGTAATATTCGCCACGTGGTCGAGGCCATTCTCCAGCACGATGATGCCC
GTGCTGCCCCTCGTTCCGG