Description :
From Genome Similarity Track
Location :
Scaffold_20:144639- 146471
Transcript NameFunction/comments
Phyci_78852ATP-dependent RNA helicase DHX8

Sequence
1832 bases(100 bases per row)
ATGAAGGCTATTGCTGATAACCAAGTCCTTGTGGTTATCGGTGAAACGGGTTCCGGCAAAACAACTCAGATGACACAGTACATGGCTGAAATGGGGTTGA
CGTCCACCGGCATTATTGGATGCACGCAACCACGTCGTGTGGCTGCTTCATCTGTGGCGAAACGTGTGGCTGAGGAATTCGGATGTGAGCTAGGGCAAGA
AGTTGGTTATTCGATGCGTTTCGAGGATGTAACAAGTCCGGAGACTGTGATCAAGTACATGACTGAAGGTATGCTCTTGCGTGAATACTTGGCGGACCCT
ACGCTGTCAAAGTATAGTGCTCTAATGCTGGATGAAGCCCACGAGCGAACCATCAATACGGATGTGTTGTTTGGTCTGCTGAAAGACCTTGTTCGGAAGC
GGAAAGATCTGAAGATTATTGTGACCTCTGCGACGCTGGATGCCGAAAAGTTCTCGAGATATTTCTTCGACTGTCCGATTTTCACAATTCCTGGACGTAC
GTTCCCCGTGGAGATTTTGTACACGAAGGAACCAGAATTGGACTATTTGGACGCTTCACTACTCTGTGTCATGCAGATCCACTTATCCGAGCCTGAAGGA
GATATTTTACTGTTCCTAACAGGCCAAGAAGAAATCGATACAGCCTGCGAAGTTCTGTATCAGCGTATTAAGGCATTGCAAGAGCGTGCCTTGGCCCCGG
AACTGATTATCCTTCCCGTGTACGGTGCCCTTCCCTCAGAAATGCAGTCACGCATCTTCGAGCCCGCACCAAAGGGTTCGCGAAAGTGTGTTGTGGCAAC
GAATATTGCCGAGGCGTCTTTGACGATTGATGGCATTTACTACGTGGTTGATCCTGGCTTTTGCAAGCAGAATGCCTTCAACTCGAAGATCGGAATGGAC
TCTTTGGTGGTTGTACCGTGCTCCCAGGCATCGGCTCGTCAACGTGCTGGACGTGCAGGACGTACAGGCCCTGGTAAATGTTATCGACTATACACAGAGA
ATGCATACAAGAATGAAATGCTGCCGACGACTGTTCCCGAGATCCAACGAGCAAACCTTGGCTCTGTTGTGCTACAATTGAAGGCAATGGGTATTAACGA
CCTCATGGGTTTCGACTTCATGGACCCACCGCCTCAAGATGCCCTTGTTATGGCTCTGGAGAACCTGTACGCGCTGGGTGCGTTAGATGACGAAGGATTG
CTAACACGATTAGGAAAGAAGATGGCGGAATTTCCAGTTGAGCCGAAGAACGCCAAGGTGCTCCTGACCTCGGTGGTTCTTGGTTGTGCTGAAGAAGTGT
TGACAATCGTGGCAATGCTGTCAGTCGAGTCGGTCTTCTTCCGACCAAAGGAAAAGCAGGCGCAAGCTGACCAAAAGAAGGCCAAGTTCCACCAGCCCGA
AGGTGATCACTTGACGTTGCTGGCTGTGTATGAGGCTTGGGCAAACTCCAAGTTCTCGAACCCGTGGTGTTACGAAAACTTTATCCAGGCGCGCGCCATC
CGCCGAGCTCAGGACGTGCGCAAGCAGTTGCTTTCCATACTGGATCGGTACAAAATGGACGTGGTTTCCTGTGGTAAGAACTTTAACAAGGTCCGGCGTG
CAATCGTGGCAGGGTACTTCGCAAACACAGCGAAGAAGGACCCACAGGAGGGATATCGCACCATGGTTGAGGGTCAACCCGTGTACATTCACCCGTCAAG
TGCTCTGTTTAACAAGAGCCCGGAATGGGTGCTCTACCATGAGCTTGTGCTTACCACGAAGGAATACATGCGCAACATCATGACAATCGAACCGAAGTGG
CTTGTGGAACTGGCGCCCGCCTTCTTCAAGAA