Description :
From Genome Similarity Track
Location :
Scaffold_533:14461- 16590
Sequence
2129 bases(100 bases per row)
GCAGAACCTGATGCAGCCCGAACCAGCAGTTCATACACATCTATTTCCTTGGGTAGCATACCGTTGAATTCGGAATCATGGATGCACCACCAGGATGTTT
TCGCTCCAAAATTGGCGAATTCTTCCAATAATCCGCTCCTTGGTTTCTTCATTCTGTAGAAACCTTTTCGTTCTAAAATGTGTTATATCCTTTTTTCATC
ACATTCCGAATGTATTTGCAGCGCTGTCTGTTAATTAAGCGCGGTTCCAGGCTTCCCACGCTGGGCAATCGTAAGACCAAGTAGACCCGTCTCAGTGAAC
GCAGACAACAAATATCGAGCTAGGATATCACACTTCTTGGCATCACCTTCGTTGGAGGGGGTGTTTCTCCATGTTGGCGGTGGCGCACGTCTAATACAGG
AGTGGGCATCTTTGCATGTATGAATCCGTGGTGGATTTTATAAAGGGGGTGGGATGAAGCAAAAGGGAACCCAGAGCGGGCAGGTCTCTCAGGCGTAGCC
TTACCAGATTTGCTGGGTTTGGCTGGCATTACGTCAACTATGCTGTCAAACTCCATGGGGGGATTCACGAAAGAGTCCCCGCGGCTGTGGTATGGCTGAG
CTTGCCTAAAAACAAATAAGTTTGCCTTCCACTGTGAACGGCTGGACTCCACTACCCACACACCGTACAGGGTGGGAGGTCTTAGAATGGTCTTCTTCGT
TAGCCTGGTTAACTAGCTCAGCTAATTCATTCTCCACACTTTCATGGTCTGCCACCGACGCACATGCATCAGTATCCTCAGAAAGGCTGCCGCTTCTCAG
CAGTTCAACATAGTTCATCAATGCAAAAGGAAACATATACCAAAATGTGTTTCTTGAGATGAAGGACAGTGTCCCGTGATAGCATACATCATTAGTGCCT
GGGACCATTCATGGGCCCCCGAAAAACTGTTTACCGTTCTTGCGGCCAGATATTTGTCTACCCGCAATTCGGTCCCAGAATCTCCGGTTCGACTTTGAAA
TTTATCTATATGCTCTAAAGCGCTGAGTAACGCCGACCCAGCTCCTTTCAGAGCGGTCATCTTTGGTCATGTAGGCTTGTTGATATTCTTCAATCATATC
GCCGGAAAATTCCCCGTTTATGACGGACGAGTTTGTATGAGAACACGTTAGTGCTGCAAGAGCCAGGTTGGTTTCTACAACGTGACAATCTGTTTCAGGT
CGACCAATTTCCCACAAGATAGGACCTTGATTGTGCGGGCGGAAGCATTGACCAATTGTTGCTGAAACCCAGCATCGATGCTACACAGTGCACACTCTGG
CAGAGACCGCCCCGTTAAAATAGGAGATATGCTTGCAGCCATAGTTCCCGCTTTTTCGCGCGTCACAATCAACGGGTACGTCACGCGTTCGTGAATGCAC
ACAGGACGGGCCAAGCGACACATATATTTGCCACGTTTTCCTTTAAAACAAGTAGAGGTGTGCGAGTGAAAGTTTGTGACGGCTGCTCGCGTTTGAGCCG
CAAACATGAACGCTTGATAGTCGGCCGATGCACTCGGTAAATGGATATTGAACGCTTTCGGTGCCGTACTCAACTTAGTTAGCCAATCGTCTCGCCGTTC
GTGGACACTTTCTTGAAATGTGTACAGCAAATCGATTCCAGCCACTCTGCCGCCCGGTGCCGCAGTTCCCGGGACGGCACAATGCGCGACAACAGCTCTG
GAGTGAATGTTGAGCCATATAACGTCATGTGAATATGAAGTCTACCgtccttctgcagctcaacGACAACAGCATGAGCTACAATCCTTCCGTATGCCCC
CATTTTCCGCTGAGAATAATCGCGCGATATTCGAGTTTCAGTGGAGCGTTTGCACAACAATATATCGTTGTAAATCTGGCTCACGCAATGACCGAACACG
CGCGCCGCAAGGCCCGGGTACAAGTTCGAAACAGCGAGGCGACGCCTGGCACTAGAATGCACTGCTTCGGGAAGATCCCCATGTCGACATTCTTTATGTT
GATAGAAGATTGCAGGTCTATTACAAGCCTGATCATGACGCAGCATTACATTTTGGTGCAATTCTAGgtcgtggtgctcatgcGGGGCTACCTTCACCCA
GTGCTGCGGAACACCATATCGCGCTCTCA