Description :
From Genome Similarity Track
Location :
Scaffold_1086:1446- 6547
Sequence
5101 bases(100 bases per row)
ACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCTCCATTAGTCGGTGTCTGGG
CGCTGTTGGTAAGTTGGATACAGCAATCTCGCAGATTTCGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCA
CCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCC
GCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCT
CGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCTGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTACGCATTGCAGATTCACCGGTTAAGCCA
ACACCGTACCTAAACCCAACCCCGCTAGTCGAAGCAACGAGAAAGAAGACGAAAACAAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAG
AAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCAT
GCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGT
TTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGCTCGAAGCAGACGATATCTTCGAGCTAGACTTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTG
CCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCTAGTGTCGTCACCGAGGATCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGC
TGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCTGGCGAGGATCCGGGGACAGGAA
GTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGATCTGATACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAACCAGTGGGGT
TATCGTCAGATCGGGCTCAAGGTAATCGCCTCACAGATCCTGATTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGTCACCCTGCA
GCGACACTTCAAAGCTGCGATGAGTCGTTTCCTGGCCGAAACAGGGTATGAGAGCGCCCGTGCCACAAGCGCAAAGTGCTCCACGAACATGGGACACGAG
ACGTGGAGATGGGAGTCAGTGGAGGGAGACAACTCTCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCCCTTCATCAGCGGTGGTAACCACAA
GCGCAGTCGGGGCGGGTGGATCGTCCATGATTCAGAGGGTACGGATCTCAACCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAAAGCCG
AGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGGCCAAGCCTCGGATGCTGAGAAGTGTTTGACCTTTGCGGGTCTGCTAACCGGCCAA
CCAAGAATTGGGATCCGCACCGGGCCGATCCCCAAGAAAAAATGGCCAGGATCTGCGCAGTTCCAGACACAGTACTGTGGATTGGGAGTGTCGGTGGCAC
GACATACTACCATGCTCGCGCAGATCGGATGAATCCCCGTTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAAATCAAGGATG
GGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGACGTGGATCTGGTCGACAGGCTGACCCTGTTACGACTTCCCGACGC
AGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACG
CCTACGGCCCCAGCTCGACGTGTCCACCAGGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTC
AAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAGCTCTCGACCGGGGGATACCGTACCCGGGGGCCGTGGGATGTACAGATCCCG
AGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGT
GGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGGGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACC
AGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTA
CGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATC
TACATGAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGC
ACGTGGTTATTGGGAGAAGCGCCAACATGGTCAATGGTTTGAGCCTACCAAGGGTAAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCC
TCTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGTCAAGG
TAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCA
AGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTG
GTATACTGGCTCGATATTTGGGTTGGAGATCTCGCGGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTATCAGCCGGAGTAAGCTTGGATCTGGCAG
ATGGAACACTGTGTTTCCCGGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCATTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGAC
CTGGATTGAGCCCGGAGAAACCTGGGAGCTGCCAGATCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGAATGCCTACC
GTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGG
CGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGTCGCTACAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGA
ATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGTCGG
ATTGAGATCCAAGCGATAGAGGTTGGATCCAAGACTGGGGATGATCCCCAGAGCAGGCCCCTAGATAACTCAGGGTCGGTGGATGAAGGATCGCAGAGGG
CTGAAGCCGGGTCGCCAGATCCCGCTGACCCCCGAGTGGATCCTAGCTGTTCATGGGACAAAGTGCCTGGATCCTTATCGCGAATGGCAACACTAGTCAA
ACAGAAACCGTCGTGTTTAAACTCGCTCGATGATCAAGTCGATCCAACTGGTGGCTTCCCCGGTACCGGGGTACCGGATCCCACGAAGACAGAAGGAATG
ACGAGTGAAACAGGGTCGCGGTGCTTAGAACCAATGGTGGATCCGACGAAGACAGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCG
ATGATATCGGAGAAGGCCTGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAGGTCACGGTTGATGATATCCAAGTGGAACCAGGGACGAACGAGCC
CGCGGAAGTGGATCGGTTACGTCAGAAGATCTGGGAAAGCTGACACCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGT
GACATCGATGTCGGCGACACGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGACAAATTATCGGATCTGATTAAAAGGCCAGCTG
CAAGCCAAGACCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGTGTGGATATACGTCTGTGCATTGATTACC
GGCTAGTTAACGGCCTGACCCGATTGATGGTGTATCCAATGCTTCTAATCAATGAGCTATTGGAGGATTTGGATAAAGTACTCTGGTACTGTTCTCTTGA
CATGGCCAGTGGTTTCTGGGTGGTGACTATGACGGATCGAGTCCGCGCAATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCG
TTTGAATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCGAAAGGGGTGGATCCGGGG
AAGATCCTACCGAAGTGGATCCATTCGAAACTGGAGAGCCAGGGGATCCTGGGACCCCGTCTGTCTTAGGACGCAGATCTTATATCAACGACATTCTAAT
CCCGGCAGAATCGTGGGATCAGCTGTGCGAGAGGGTGACATCCCTACTGGAGGCGTGTACTAGGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGG
G