Description :
From Genome Similarity Track
Location :
Scaffold_3019:1446- 2683
Sequence
1237 bases(100 bases per row)
AAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTTATAGGACTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTTAG
AATTCCCACGTGAACTCTAGCTACAAATGTAGTTAGGACGTTCCCACAACATTACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCC
CTGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAGTAAAAATAGGAACACGCTACTAGCACGAGCAAAGCTAGC
AGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGTTGGAAGAATA
AAAGGGAGGCATTTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTT
GGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGT
CGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAG
TGAACATTGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACCGTCGCATGAGCATCTTTATCGGTTCCGCGTCCTGGTCCCAGACGGTTAA
CGTGTCTTCCAAGGGTCGCTGAGTCTTCTGCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCC
ATTATTAATAATAAGGACAGCCTGGATTCAGTGACATAGGGCCGTATCCGATACTTGTTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGG
CGTCTCCGTACATCACCCGACCGAGGGTTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCA
CTACACCACAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAG
CCGGTAATCAATGCACAGACGTATATCCACCCCGTTC