Description :
From Genome Similarity Track
Location :
Scaffold_484:14459- 16512
Transcript NameFunction/comments
Phymu_g10291myosin-like protein

Sequence
2053 bases(100 bases per row)
ATCTGCACGAAGCCTCCATTCTCAATGCACTGAGACTGCGCTACGAGCGCCATGCCATCTATACACACATCGGGGAGATCCTCATCTCCATCAACCcgtt
ccagcacctcccGCAGCTTTACGGTGACGAGGTACTCCAGGGCTACGCTTACGACCGCAACGACGACCGTGTGACGTCTTCAGATCCAAGAGAGCCGCAT
CTCTTCGCGGTGGCTCGCGCAGCTTACATGGACATCGTGCAGAACACCCGGAGCCAGTCCATCCTCATCAGTGGTGAGAGTGGCGCGGGCAAGACTGAAG
CGACGAAGATCATCATGACGTACTTCGCCGTCACGTGCGGTACCGGCAACAACCTGACAAAGACACAGGAAACGGGCGAATCCAATTcgcctccagcgtc
tccgtccCGCACAACAATTGAggagcaagtgctgcagtCTAATCCTATTCTGGAGGCGTTCGGCAACGCACGCACAGTCCGAAACGACAACAGTTCGAGG
TTCGGCAAGTTCATCGAGCTGCGCTTCCGGGACCAGCGACGGAAACTTGCGGGTGCTCGCATCCGGACGTACCTCCTGGAGAAGATCCGAGTCATTAAGC
AGGCTCCCTACGAGCGCAACTTCCACATTTTCTATGAGCTGCTGAGCGCAGACACTAGCTGCGTGACCAAGGAACAGAAGCAAGCGTTGGCGATAACTGG
AGGTCCTCAGAGTTTCCGGTTGCTGAATCAAAGCTTATGCTCCAAGCGACGCGACGGTGTCAAGGATGCCGTGCAGTTCCGTTCGACGAAGAGAGCCATG
CAACAGCTTGGTATGAGCGAGCGCGAGATCGGTGGAGTACTGGAAATCGTGGCTGCCGTGTTGCATATGGGCAATGTCGATTTTGAACAAGTACCGCACA
AACGCGAAGATAACGTGTTTGCTGACGAAGCACGTGTGGTGACTTCGACGTCTGGTGCTTGCAACCACTTTACAAAGGCAGCGGAACTGCTTGGAGTCTC
CACAGAGGCGTTGGATCATGCACTTACCAAGCGCTGGATACACGCTTCCAACGAGACATTGATTGTCGGAGTTGACGTTGCCCACGCAAGGAACACACGC
AATGCACTAACCATGGAGTGTTACCGACTTCTATTTGAATGGCTCGTAGCGCGTGTCAACAATAAGCTTCAACGACATGCTGGTACTTCCTGGGATGCCG
ACCAgaatgatgacgatgaggaggaagactCGAATGATTTCATCGGTCTTCTTGATATCTTTGGGTTTGAAGATATGGCTGAAAACTCCTTCGAGCAACT
CTGCATTAACTACGCCAACGAGGCGCTTCAGCACCAGTTCAACCAGTACATTttcgaggaggagcagcgaCTGTATCGCGACGAAGGTATCCGTTGGAGC
TTCGTAGATTTCCCGAACAACCGCGcgtgcttggagctgtttgaGCACAAACCGATTGGCATCTTCTCCCTCACAGACCAAGAATGTGTCTTTCCCCAAG
GAACCGACCGTGCGCTCGTGGCCAAATATTATCTGGAattcgagaagaagacgcagcaccagcacttcCGCTCGGCCCCAGTGATTCAACGTACAACACA
ATTCGTTGTAGCGCATTATGCCGGATGTGTTACTTACACCGTTGAAGGGTTCCTAGCGAAGAACAAGGATTCCTTCTGCGAGAGTGCAGCCCAATTGCTG
GCTGGGTCGTCTAATCCCCTCATCCAGGCTCTAGCTGCCGGATCTCCTAATGAAGATGGCGTCAATGCTGACGGTGAGCTTGACGGCTTTGGTGGCCGCA
ACCTTCGACGTGCCAAGTCGGCCATTGCAGCGGTCAGCGTGGGCTCGCAGTTTAAGATCCAGCTGAATGAGCTGTTGAAAACCGTTCGGGCCACTACTCC
TCGATACGTGCGCTGCATTAAGCCAAACGACTCACACGTGGGATCGTTGTTTCAAAGCAAGCGAGtcgttgagcagcttcgtagcggtggagttcttgaa
gctgtgAGAGTGGCACGTGCAGGTTTTCCTGTGCGTCTTTCACACAAGCAGTT