Description :
From Genome Similarity Track
Location :
Scaffold_305:14456- 21360
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_305-fgenesh-gene-0.2GRV2 (GRAVITROPISM DEFECTIVE 2)
Pytiw_DAOMBR242034maker-piw_contig_305-fgenesh-gene-0.3PH domain containing protein
Pytiw_DAOMBR242034maker-piw_contig_305-fgenesh-gene-0.5Transmembrane protein

Sequence
6904 bases(100 bases per row)
CTGTTTCTAGAGGAGACCGGGCTGAGCGTGCTCGGCGACTCGCTGGAGCGCATGCTCAACCCCACGTACCAGCACCTACTCAAGGCAGAGAGTGGCAAGG
GCATGGCGAACACGGCGCGTGTGCTGCTCTATCGAATCACCGACGTGCTCACGACGCTCTCTTCGCAGGCTGCGGGCATCCAGGCCATCCAAAAGAACCC
GCAGGTGCTCACGTCGCTGCTCGAGCTCTCGTCGAAGAAGACGATCATGAGCTACTCGGAGGACGCGGCGACCGTCTGCCTCAACTGTCTGGCAAACCTT
TGCTTCTACGACGAGCTGCGCGCGCTCGTGGTTGAGGGTGGCGGGCTGTTGTATCTGATTGAAACCAGTGCGTTCTGCCCGGCTGACGATATCTCCGAGA
CTCCGGCGTCTATCGAAGATGGGAATGCAAACAGCGATGCACCCGTGATCCTTCAACGGCGACCCTCACGATTCTTCAACGCAATTCGAGGCGCAGCACT
CACATTGCGAGCGTGCCTGAACGACAAGAACTTCAGCGAGGCGTTGTCAACGTACCAGGTCATGAAGCAATTGCTGACGCCGAGCTTTGTTCGGATCCTG
AGAGCGTCGTCCGACAAATTCATCTTCCAACTGCAGACGACGGAGGACATCAACTCGTCGACGCTCGTCTGGACCAGCAGCATGCGCAAGCGATTAGAAA
ACTGCATCGTCCACGAGCTCGCGAAGGTGAAGACCGCGGCACGAGCCGACATCTGGCCACGATGGGACCCGGACCACTTTGTCGCCGCGGACTCGTTCCG
CTACCAGTACCCAGAGCTCGCCGACGAGCTCATCATCCACGACGTATACCTCAACAACTTTGTCGTGGCGGCGGGTATCGACCTAGATGACATCAGCATG
TCGAGCTTCTCCGAGGCGCTGCTGATCTCGATCCAGAGCAACGAGAACGTGTTGCGGATCCTACAGCAGGTACGATATATATTTTTCCCATCTCAAGTGG
AATCTGTTGTCTGGTGTGGCTGGTGAAATTCTAACTGACTGGTATACTCATGTTATTATGGACATTATGATGTAGCGAGGAGCCAGCGATCGTGGGAAGG
AAGTGTCGGTGGTGGTGATGCGCCAGGCGCTCAACAAGCTCGTGAGTGCGCACCCGCAGCACAATCTCGAGGTGGACGCGGCGCCGCCCTCGGCAGCAGA
CTTGCCGCTGCCGTCGAGTCGCAAGACGTCCGGTGCGCGCAGCTCAGAGGGCCAGACGCCTCCCAAGACCGCTCACAGCCGCACGCACAGCTTTGACACC
ATGGGTTCAATGGACCCGGAAGACCTGACCGTGTGAGCGTTGCTCTCCTATCTGTATCCTGGTTCGCGTCTTCACCAGCCAGCGGACCGCGCCGCATGAC
ACTTTCGCCAGATTCGCCAATGGCTTTCACTGCTCTTATAATTTATATACTCACATTCTATCCAGAAGCGTTCATGACAGGCTGACACATGCAGTGCGTG
GTGATCTTTTGAGGTAGTACATGTAGCCATCTCCCGATTTCCAGGAGCTCCAAAAAATTTTCCGAATTGCCGTCCGATTGTGGCATGATGGTGGGAGTCA
GAGCCAGTGACTTCAAGGTCGGACCAAACGGTGTTGGACCGACACGTATGCCTCGTTTTAGCATGGAGCGCACGCACATTCCCGATCTCCATGTGGTCAC
GGCATGGCCACTCTCTCTCTCTCTGTCTCTCTCTTCAACTGACCCCAGGAGCTCTTTATCAGAACTGGATCTTCTTGAGCAGGTCAGTCAGCACACGTTC
TTATCAGCAGGCGCCGCGTGCTATTCTCAGCACGGTCTCATTTGCGCATAGCCCCCTCCTCAGGCACAACCTGATCTTCTCCCCCAGGCGTCTCTCTGTC
CACGCGGCCTCCCATGGCGACCGAACACGAGACCGTGCCGCTGACGCTTGCGGGCGTCAACCTGCTCATCGGCAGCCTCGTGCCGAGCACGTCGCTCGCG
TCCTACGAGGACGCCAAGAAGTCGCGCACGAGTTCGCGCACGAGTAGCAGCGGCAGCGGCAACAACGCCTCCTCGGCTTCGTCCAGTGACTTGGTGAAGC
TGCAGCAGCCGCACTACGAGCGCGAGAGTCGCGCGCCGGGCCTGCACCACCACCACCACCACGAGGCGTCGTGGTCCCAGCTGCAGCTGAAAGACCGCAT
GGCGTGGGCACAGGGCTTTCGCATGAACAAGAAAGGCGGGCTCGTCTTCCTCGACCAGGAGACGCTCAAGAAGCAGCAGGGCGTGTTCAAGGACGTGATG
CTCCAGGTCGGCTCACAGCTGCTCGGCGGCACGCTCGCCGTGCGCATCTCGCTGCCGATCCGCATCTTTGAGCCGCGCACGCTACTCGAGCGCGTCACCG
ACGCGTGGAACTACGCGCCGACGCTGCTCAAGAAGGCCGCGCTGAGCACGGGAGACCCGCTCGAGCGCATGAAGTTCGTGATCGCGTTCGTGGCCGGCGG
CTTCCACTTCTGCACCGGGCAGCTCAAGCCTTTCAACCCGATCCTGGGCGAGACGTACGAGGCCACGTACGCCGATGGGACACACGTGGCCATCGAGCAC
GTGAACCACCACCCGGTCAAGTCGGCGTTTACAGTCACGGGCCCCAAGGGGCTCTATCGGCTCTCGGGCGTCTACGAGTTCGAGTCGTCCACAAGCCGCA
ACGCGATCATCAACCACCAGCTCGGCAGCGCGAAGATCGTCTTCCAGGACGGCCACGCGATCTCGTACACGGTGCCGCAGATCAAGATGAGCGGCCTGCT
CTTCGGCGAGCGCGTAGTCGAGCTCACGGGCGCTTGCAAGTTTGTTGACGCGAAGCACCACCTCGTGGCCGACGTGAACTTTGGCGCTAACACGAGCTTC
CTCTCCAAGTCGCATGGCGAGGACATCAAGGGCGCGATCTACCCAGCCAAGGTGAGTCTGCATTGTAATTGAATCTTCTTATAGTGAGCTCTTCGGAATC
TGACTGTCTTGCTTGTAGAAATCGGCCAAGCACGCGCTGTCGACGATCCAGGGCTCGTGGCTCTCGCACCTCCAGTTCGACAACAAGATGTGCGTGGTTT
TACTTGTCCAGTGCTTGAGGACATTTTCTGTCCACTTGTAGCTCTTCATTATCTGACTGGACGTCTTCTTGTGGTGGACACTTTTTGTCTGTAGCTACTG
GCATGTCGAGTCCGAGCCCGTGTTCGAGCACACGCCCGTGGCGGACCCGCTGCCGTCGGACTCGCGCTTCCGCGAAGATGTCATCGCGCTCAAGGTAACA
AACCTTGAATTTGGTTCGTGTGAGATATATTTTCTAATGCTAAGGATTAATGATATTTGAAACAGAATGGCGACTCAGTGCTCGCGCAGTCCGAGAAGCT
CCGCCTGGAAGAGCTCCAGCGCGCCGACAACAAGCTCCGAGGCGGCCACGCATAGAGAGGAAGCTGCCATGCGAAGATGTTGTAATTATTATTTTATAGT
TTTTCTTTCATAGATCAAACACAAACATACGTGCAGCAGCCATCCTCAGTTTCAAATGCTTCGTTTCAATTCTGTTTAGAAAAATGAAAATGCAGGTGTC
TGCAAAAATGGCGTCACCACTGTGCCGACCATCTCTCTCTTCTCGTCTCTCTGCTTGTTTCTGTGCGTTGGTTGGGTTTTCATCTAAGCGTGGGTAGCAG
TGGTGCTGGGCTCGCAGCGGTCGGTCTCTCTTTTTCTACTTGGTCTTCTTCTTGAGCTTCTCCTCGTCCTCCTCGGCGGCGTGCTGCTGCGCAAACTGCT
CGACGCAGGAGACGGCAAAGTACCCGATGAAGAGCACCATGACGAGCGAGCCGGCCTGCGAGATGAGACTGGACTTGGCGACCTCGCCCGAGGCGTGCTC
GGCCGCGGCCTGGCCGCTCGCCGAGTGGAACTTTTCGCGGCACTCGAGCAGAAAGTCGCTCACCTTGGCGTCCAGGCGCCAGGTCGCCGGCGTCACGTGC
GCGATGAACGCCTCGACCTGCTTCATGTGCTTGTCCGTGAAGATCGTGATGAAGAACGCGGCCTGCAGGTTCACTTTGATGAGCGCCTTGCCGATGAGCG
TCGCGCCGAAGAACGTCCAGAAGGGCATGAGGAAGTGGCCGCAGCAGATGCCGCACAGGTCGAACGCGACGTTCGGCCACGCCGACATGAGCAGCACGCC
CCAGAAGCCGTGCTTCTCGAGGAACCGGATCATCCAGTCCTTCATGACGTTCATGAGGTTGTACTGCGACTTGGACTCGGCGATCTCTTCAAACTCCTCG
TTGCGCTGGCCGGCGAGACGCGCGGCGCGGCTGAGCGCGTACGGCGGGATCTCGCCCGCGGCCGTGCCGGCACCCCAGAGCATCGCCGGCCAGAAGACCT
TCCAGAAGATCGCGATGAACGTCGCGCCATTCGCGAGCGGCTCGCCCTGGCACGACGCGTCGAACTCGCGGAACCACATGTGGTTACGCGAGTCAAAGTT
CACGGACTTGCACTCCTCGGCGCCCTGCACGACGAGGAAGATGTGTGGGAAGAGGAAGAGGATGCCCGAGTGCATGCCCGTGCCGAGCCCCACGGACGAG
AGCACGCCGAGGCCGACCCACCAGACGACGAACTCGACGTTGCGGTTGAAGCCGTCCAGGAGCGCGTGGTGCTCGCCCTCGACGATCGAGGCCGCGGCCC
AGAGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCGCGTCGCGTTGTGCTGCACCACGTAGAGTGCGAGCCAGCGCACGAAGCGCGCAAATACGATGCCGAAGTGGTAGAGCGTGCTCAGCGGCCGGCG
CAGCAGCGTGAGCTTCTTGCGCTCCTGGCGGAGCTGCTCGGAAAGCGCATCGTTATGCGTGGGGGACGCGGGCTTTTGCGCCTGCTGCTTGCAGCTCCTC
TGCGGAGAGGAGGCCTTGGTCTTGGCCATCACTCTGTTGCTGGGTGACGTGTGAGGGAGTGCGGGCGGGCGTCGCTCGTCGATCGCAGTCTGAAGCTCAG
GAGCCGATGACGTTCTCTCTGTCCCGTGGGTTTCGCGATAAGAAAGGGGAAGAGAGCAACGTGGAGGAAAACTGGGGATGTGTCCTATTAATGCGAATGT
GTCCTATTCATGCGGGATTAGATGTCCTATTTATCCTATAATAAACAGTATGCGTCGATGTAGTAGAGTGCGCGCATTTTCTAAAAGGACAGAATGAGGT
AGTACAAAACACGACCTGAATAGAAGGCTCCCCCCTCTGGGAGGTGATACTGACCTCATTATCGGATTGAACGAGTGTAGCCATGTCAAAACGCTATTTT
GGGTAAAGCACTTGGAATGGCATTGCCATCTCATTCGGAGGCCATGGAAGAGGCGGACGACGACCTGCTGGAGCGCGCGAGGCGCTTGTGTCTCGCGGCG
CAGGCGATCTCCGCCTCGCTGCCCGTGTTCTCGAGCCTGAGTGGCGGCAACCAGGACGAGGAGGTCCCTGCGAGTGCTGCCAAGAAGAGCCGTGGGGATG
CAACGAACAAGGCTGCTGCTGCTATTACTAGGAAGCACATACCTGATAAGCAGAGCAGCCTCAGTCTTCCTGTTGCGGTGACTCAGACTGCTCCGACAGT
GCCAGCCGTGACGCGGAAGCGGTCGCTCAAGAAACTGAAATCCGAGCTGAGCTCGACCAACCAGGAGACTCTTCCCGAACTCGCCATCTCCGATGAACAG
CGGCGCCTGCGTGAGGCTGAGAAGATCCGCCACGCCCAGGAGCGTGCACGTGCTCGCGTCTCCCGCACAAACCAGTCGGATCAGCTGGAGGCGGAGCGCG
AGAATGAATCACGACGGCAGCAGCTGCTGCAGCTGGAGCAAGTCAGCGCCGAGAAAGCGAGGCTCGCTGAGGAGAGCAGACTGCGTGCAGAGGAGCGCAT
CCGCTCAAAACGGCAGCTTCAGCTCGCACCCATCGACAGACAGCAGCAAATACCGATTTGTCCGGAGAAGTTGGCGTCCGATCTGGTCAAGATCGAGCGA
TTCCGACGCAAGACACTCACGAGATTGCACGCGTACGTGGGGGTTCTTTTTGCAACTCTGCTATGTGAAGCCCACGACTGTAGTCTCATCTGGTATCCGG
TGTTTCTTGTGACTTGTGACTTCTGACCGAGCTAGGCTGCCTTATACACCTGATAGTGTACCGACAACGAAGTCAGTCGACCAGAGCGACTTAGAGCACC
GCTCTGCCACTGACATGGAGCCAGCTGAGCGAGATGAAGATCTCGAAGCTGAGCTGAGGAGACAAAAGGAGAAGAAGCTGAGACAAGATACACTGGAGCG
AGTGCGGCGGCAACAGGCGATCGAAGAAGATCAGCGGCGGTATGTAAAATGCTGCTGCCTAGCAACTCACGTCTGAGAAGATGAGCACTTGCTCACCTCA
TTGACTTGGCTACTTTATGTCTTCGAGCAGGAAAGAACAGGATCATATTGAGCAGGGACTCTTGCGCTACAAGAACCGCCAGAAGGAGTTGGATCGCGTC
GCGAAAGGCTTGGGACCGCCGAGGAAACCAGAATCTACCAGCAAACCACAAGTTGAGGTACCGTACAAACGAGATTTACAAAGACAGGTTTCGATGTTGA
GACTATATGGCTTCACTGACATAACGCAATTCTTCTGCACAGACTCATCCAAACTTCAAGCCATCGCATGACTCTGACAGCCTCACTGACGCCTTTGAAC
CACC