Description :
From Genome Similarity Track
Location :
Scaffold_30:144527- 149227
Transcript NameFunction/comments
Phyra_78233Major Facilitator Superfamily (MFS) putative
Phyra_78234lysosomal beta glucosidase, putative
Phyra_78235hsp90like protein putative

Sequence
4700 bases(100 bases per row)
AAACACTTCATCATCGCGGCAGGCGACGGGTAAAATTAATAGTTTGGTGGCCGCCGTTAAAATGGTTGTGGGCGAAGAGCAGCAAGCCCACCACCTTCGG
AAAGCGTGCGTGCAAGACCGAGCTGTGTGTGTCGAGTGCATCTGGTTGCAGTTCAATGTCTGCCTCTAAGTTGAAGCGTTGAGTAGTCGGTCAGTGAGCA
TGTTTCAGCCATTGGTACCGCCAACGCACTCATCTGGTCGGGACCACGTTCGCCGGAAGAATGCATCAACGGCATCGACTGCTAAGAAGCAGCGACCTGA
GAAGCACTAAGCCGTTTCGCCAATGCGACGAGTCCAGCATGAAACTACTTACCTGTCTGCAAGCTGAGACCGCCGCTCCATTCGTTCTTCCGACGCTCTA
GCATGAGAGACGTGTCTTGGGGCCTGACGGAGCACAATGTACAGCTCGTGTTCCTCTTCACGGTGACCTACTGGTCTGCCAGCAGGTACGCCCCAAGTGA
ACTGACACCCTTTCCTGCATCAATGCTGACCTTGTCGTAGTATTATTTCGCAGCAGGTGCTATCGGGCTACGTGTACGTGTTGACGGCTTCCAACGTCCC
TGTGGGCTTCGTCAAGGGCATTCAGGGTCTAGCCCAGCTACTGTGCGCATTCCCTGCTGGTTATGCAGCGGACAGTACACGTCGAGACCGGATCCTCGCG
CTTTCAGGCGTTCTCGGCGTCGTGGCTTCGGTGCTGACAGCGTTGGCTTTCGAGTTAGGCGACATGGTCCTCATTTACGTGGCTTTCGGACTATGGGGGG
CCTTCACTGCCTTCCAGAGCTCGGCCATGGAGGCTCTGTTCGCTGACTCGGTGCCGGTAGGGCAAAGATCAGCGCCGTTCACGCTGAAGTACGTCATGCG
CAACGTCGCGCTTGTGCTCGGGCCTTTGAGTGCGATGCTGTTGCTATGGAAGCACGGTGATGCGTGGACGCTTGCAGCACTGCGACCCGTTCTGCTTTTC
GGAGCGTTCATCGCGGCAGTGTCCATGGTCGTGCTGTTTCAGTTCAACGACGACCTAGCATTTGAGAACCGGCAGTACGTGTTCGCTATCGAGCGCGAGC
TGAGCTCCATCGAGCGCAACTTCACATCCGAGTACAGCGAGAGAGAAAGCTCCGCCTCCGAACGAGGAGGGAGCTTTTCTCGTGTGCACATGCCCTCGAC
AAGCGAGTTCTCTCAACTTCTCCGGTCTTCAAGGGTTCCTTCAGTAACCAGCGGCTACTACTTGGCTGCTCCAGTGCGGAGTGACGATGGCGAGGATGTC
CCGGTACGCCCCGTCATGGCGTGTTGCGGGATGCTCGACACTGCGCACGTCCCGTACCTGCTGTTTGTGTCGGACTTCCTTGTGAGCAACGGCACCGGAC
TTGTCACGGCGTTCTTCCCGCTCTTCTTTCTCAACGAGTACGCGCTGTCTCCGGTTCGAGTGCAGACCCTCTTCGCACTGCAGCCACTGGTGATTGCACT
GCTGTCGCTCCTAGCGCAAATGGTGTCGAGCGCTACTGGGCGAATGTCCATGGTCGTGGCCACGCGTGCACTTGGCACCATCAGTTTGCTGCTGATGGCA
GTCTCGCACGACGTGACCGACCAGAGTGTGCTGTTCCTAGCGCACGGAGCGTTGATGCAGTGCACGGAACCACTCCGGCGATCACTTCTCATGGATTTCG
TGCCCAAGACGCATCGTGCGCGTTGGAACTCGCTGGAGGGACTGACTGTTGCCTCTTGGGCAGGTAGCGCCGTACTCGGTGGAATGATCGTGGAGGCTTA
CGGATACCGACTGTGCTTCGTGGCGGCAGCGCTGGTGTATACGTGCGGTCTCGCCCTCGAGACCATGCTCATTCCTCTAACACGGCATGCTGTAGAAACA
ACGGAGGTTCAGAAGCCTCATGCAGAGAGCAGTACGTCACGATAACTCATAAAACTAAGAACTATTCGGTTGTGATTCTTCCTCTCAGACGATTTTTGGA
GCGATGAGAATGTCGGTGAGAGCACGTGGCCTAGAAAAACCAGCGTACACAATTGCAACTAAGTCAGTTCCTTCTCCGGAGTCGAGGCAGTAAGCACGTA
GCATCGGTTGATACGGGACAAATCACGACGAGTTTGTTCTTGACTTGGACTGGCGAGACGCTCGGCAATGATGTATCTTACTCCTCAATGGATCCTTCGC
TTTAAAGCGCGATCTGCCAGTGCATTCTCAATGTACTGCCGGTTGACGACAGTGTTCTTCAGCCCGTGGACAATGAGGAAATTGGTGAGAGCGCGCACGT
TGTTGGCGTCGTACGTTGCGCCATCATTTAGCTCCAGCGCAATCTGCGTACACAGTTGGAGCTGCGTCAACTCGTGCTCCGGTGTGGAGGCAGGGGACCG
CCTCGTAACAGCGAAGCCTCGAACGTTGTGCGTTAGTCCTCGAAGCATTTTGTTTTTGACTTCGATGGGAGCTGCGTGCGAGACGCGAATGACGACGTCG
CGGTCGGCCTCCACATATCTGCGCACCACTTGCCTCATCTTCACGTCAGCGCGGGAGTTGTTGGAGTAAACCTCCTTCGTAAACTCCTCGATAATTGTGT
AGGGCTCATCGAGGCTCTGGGGATAAAATAGCGAGTTAGAATACCCCAAAACACAAACCACACCTTCTCCATATCCCCCACCTTCGCCATCTTCTGGTAC
AAATTGCCGGACGCCATGTGCTTCTCTGCTCCTTTGAAATAATCCCACGACACTTGTGCCGTGTCTTGCAGTCCAAACGGCAGGTCTTTATACGTGAAGA
ACTCGAGGTACTTCCCGTCCACGCCTTCGCGCATATGAACATCCTCGATCGGGATGTTTCTACTCGTCAGGCCGTTGGCTGCAAACACGACATCCACGTC
TCGGTACGCGGCATCCAAGCGATAGAAAAGCTCTCGGAAGTCTTCCACATCGCCGCAGAAGTCCAACACGTCGATCACTGGGTGGTTGGCACAGCACTGG
CTGATGAGCGACGCACACTCGTTGTTCTACAGTAAATGACACCAATTAGCACCAGCACTTCGACAACTCTCCACCTGAGGTTCTCACCAGCTGCCGCGTC
CGCTTGCGGATCAAGACCCCGAGACTGTCCGCCACCTTCTTCTGGCGCTCCATCGCCAGCCTCAGTCGCACGTTGTCGCACTCGGCCTCCTCCCTACGAC
GTCGCTGCCTTTCGGCTTGCTCCTGCCACAAGCTCGGTCTACTGTTTGTGACTGCAAGCAGCGTCGTCTTGGTCCTCGTCTTGTGGTTCTGCAGAACATG
CAGATTCAGCTGCAGCTTCTCCATCTGTTCGCGGAGGAACGCGATCTCCCGCGTCTGCTCGTTGCGCGCCCGGTTCGGGTCGCTGTAGACGCCAGCCTGG
CGCAGGAGCCGCTTGCGCTCGGCACGTCGGCGGCGCTTCTCCTCTTTGGGCAGAGGCACGACTGAGAGACTGGTCGCGGCTTGGACTTGTGCGTTGGCCG
GGGCGAACTCGAACTCGTCCACGAACGACAGCGCCGCCTTGAACACGTCGTCCGGGTCGTCGCCCTGGAAGAGCGCCATGACGCTTTTTAACAAAAGGTG
TCTCATAACCAGCTTGACCAATGAGAGTGCTGGCGGTCAGGTCATGCAACACGTTGGAGGTGGCTTGCCTAGCCAGCGGCGAGAAAGCGTTGAATCCCCC
AACGATACCGTTGTGTCGAGATGCTGCACCAGCCAGACCACAGAAGCTTACCTGCATCAACGTTGACTGAGAAATAGCGCTGCCTTCGACGAGGCTGTTT
ACTCTCGCTGTCTTCTCATAGATGTTGCCATTGCCCAGCTACTCCTTTAAAGCGGACGTCTGCAGCGTTTGGTTGCCTCACACAGTCCTGCTCGAGGATT
CTTCGACATCCGTGCCATTGCCAACACGGGCACACAGCTCTTCCTGTCCTGCTCAAACTTGCCACCAATACCACTTCAACGTCTGCAACTCGTCCGTGAT
TGGATAAAACCCCACTCCCTATCTACCCGTAACCGCCACAATAACTGATATCGAGAAAGTTCGATCAAGCAAGACGTCACTCCGCCACTAGCCACCTCGC
CGAATCTGCCATGGCGACGTCTGTGCCTCCCACCAGCGCCTCGAGTCTCAACGTGGGGTGGGACCCTTCTCCGCTCTCCCACCCCACCGAATTCGACGCC
AACTCGCTCATCGAACGCACGCAGGAGGTGAAAGTGGACGTGAACGACTACTCGCGCTTCAAAGGCATCGGCGACGACGACAAGGCCCCAACTAGCGAGG
GGAAGACCAAGGTGGCCCCTGCTGAGCCCGATAGCAAGTGTCGCAACTGCAGCAAAGCTGGGGCCAAGCTCAAGTGCAGCGTGTGCAAGAAGGCCGTCTA
CTGCGCACGCAAGTGCCAGGCCAGCGATTGGCAGTTCCACAAACGCATCTGCAAGAAGCCCGAGCCGCCCAAGAAGCCCGAGCCCCCGCGTCCATCGCCT
ACCAAGACAACGCCTTCAGCCGCCAGCTCCTCTGCTACTACAGTGAAGACGCCGGCAAAGCCCAAGAGCTCCAGTGCTGGGTCCGTTGTGGTGGCGGACG
AGCCGGACTTGCCCGCGGACATGAGGGGCTACAAGAACGGCCTGCCGTACTTCCACCGTGAACTGTCCAAGGAGGAGAAGAGTCTCATTGGAGACATTGC