Description :
From Genome Similarity Track
Location :
Scaffold_999:1445- 9541
Transcript NameFunction/comments
Phypl_g11992hypothetical protein PHYSODRAFT_542020
Phypl_g11993hypothetical protein PHYSODRAFT_313255
Phypl_g11994hypothetical protein PHYSODRAFT_328767
Phypl_g11995hypothetical protein

Sequence
8096 bases(100 bases per row)
CACTTCGACAATGCGGTTCTTGCAGCTCTGTCGGCCGGCGGTGGCCCGCGTTGTGGGCGTACGCGGCCTCAGCTCCGCCGTCTCCGACACGCCTCGACGC
CGCGTGTGCGTGGTCGGCTCGGGCCCCGCGGGCTTCTACGCCTCCAAGTacctgctgaaggagcacgccggcgcgcgcgtggacatgctggaggcgctgc
ccACGCCGTTCGGCCTCGTACGCTCCGGCGTGGCGCCCGACCACCCGGAGGTGAAGAGCGTGATGAACGACTTCGACAAAGTGGCGgccgacgagcgctt
ccgcttcctgggcaacgtgcgcgtgggcgaggacgtgacgctcgccgagctgcagcggcactaccacgccgtggtgctggcctACGGCGCTGCCGGAGAC
CGCGAGCTGGGCGTCCCGGGCGAGGATCTGCGCGGCGTCCTGTCGGCGCGCACCTTCGTGAATTGGTACAACGGGCACCCAGCCTTCCGcggcctggagc
tggacctgACGCAGACCGAGacggcggtcgtcgtcggccaggGAAACGTGGCCGTGGACTGCGCGCGCGTCCTCACCAAgaacgtggacgagctggcgac
CACGGACATTGCCGCCCACgcggtggaggtgctgcgcaacAGCGGCGTCAAGAAGGTTTATCTCGTGGGACGGCGCGGCAGTGCGCAGGCGGCGTTCACC
ATGAAAGAGATCCGAGAGCTGaccaagctggacggcgtcgcGTGCATTGTGGACCCGGAGGATCTGGAGCGGAGCATGACGCCCGCGTCCGAgcaggaga
tcaaggagcagcgcgcccgcAAGCGCATGAACGACTTGCTGGGCAAGGCGGCGGGGCAGTTCGACAGTGCCGGGGAGGCtgagcgcgtcgtgcagatcaa
gttcttgagctcgccgGTGGAGATCCTTGCGGATGAGAAGGACCCGACTCGGGTCGGAGCCGTTCGtgtggagaagacgaagctcGAGGGCGAGCCgaac
cagcagcgtgctgtaGGAACGGGGGAGTTTGAGGATATCCCGTGCAACCTCGTACTGCGCAGTATCGGCTACAAGTCGCTGCCTATCGAGGCTGATGCTC
CGTTTGACCCCCGTCGCCATGTGATTTCGAATGACCAGGGACGCGTTGTCACTGCGTCAAGTAGCGGCGAGAAGCAGTCTGTGGTTGGCTTGTACTGCAC
CGGGTGGGTGAAGCGTGGCCCCTCTGGCATCATTGGTACCAACATTGTGGACGCACGGGAGACGGTTAGCTGTATCGTTGAGGACTTCGCAGCTGGCAAC
TTCCTCCACAGTGAGAACAGAGCCGAAGAAGACTTGGGTGggctggaggcggtggagaagctcatAAAGAAGCGCACCCCggacaagcagctcgttAGAT
GGGCTGACTATGAGCGCCTCAACGCCGAGGAAAACCGCCGCGGTGAACTCATCGGGAAGCCTCGTGAGAAGATCACGTCGGTgatcgagatgctggagat
cgGGAAGAGTGCTAACTGATGTAACTACAGATTGAATGGGCTGGAGATGGCGTAGAGTAGAAGAGCACACGAGCTTGCAGCGTTTCTTTTCCTGACAAAA
CTACAAGAGAGATGTTCTAATTCTTCAAGCCATTGCGTTCTTTTTGGCGAGTAAGAGCGGCATTAGCGGCTTTCAGCGCTTGAGTCTTCTTGCGCTAGTT
CACGATCAAATAGAAGGTGGATACGTCAGTTCTCAGGTGCGCGCGAATTCTCGACTCCAGCCAAAACAGCTTGCCGTACCTCTTCTTCCAACAAACTCAT
CAAGCGTCGACACTCCGTTGTATCTTCGGCCGCGTCATCAGCCTGTTGCTCTCTTTGTCTCGATCTAGACCGAAGTCCATCGGTTTTGCTTTCAGGCCGT
CCGTcgtgtgcagcttcctcgCTGTGGTCGAAAGTGAATGCATCAACGAGTGGGTGGTTCACTCGATCGcgtagagctgctgcatACGTTGGTTTGGTTC
TTCGCACTGGCGCTGATACTGGTCGTGATAACTTGATTCGGTCTATCGCTCGTGGCATCGGCGCAGCTGAGCGCGGGTGTTGCAACGGGagtcgtgctgc
tgccgtcgtcatCTGACATGCCCACAACTGAAGATTagatgtgctgctgctgggatcATAGACAACAAGGCATATGTACAGTTGTTCATACAATGGCTTT
CATGTGCCGCAGCTTCGTTGGGTCCGCCAGGATATTCTTCGGCAATGAAAACGTTCTGGAACGAGAGTATGACCAAGTTAGCTACATACACAGCGTATGG
CATGGAAACTGCTTCAGTTGTCTTCTCCGCTACCCGTACCGCTGACTCGTATCCACAGCGCTTACTAGTCTTCCAACGTATGTGTACAGCTCCAGGCAAT
CCTCACGAAGGTTCTACGATAGCACAAGGATACCATCAGTACACGATCTAGTAAAAAAACAGTTCCAAACCTTCACGCACATCCATAGTATCAGTCGTAG
TCGCCTCCAATTGCTGAAGCTTGCTGTTtgcgacgccgagctcgtCCGTTTTGTTTTTCAGAGACTGTTCATACTGTTTGCATGCAGCACATGTCAAACA
CCGCACGAGACTGATATTTCTTGCTCAAATTACCTGTTGTCGTATGAGAGCGATCTCGTTCTCTTTCGATCTCTGCAAGGCTGCCACCCGCTGGCGTAGC
CGCTGAAAAAGAAGAACAGGAAGCATATTCGTCAGGTTGACGATCAGCTCAACGAAGAGACGGAAAGCATTGCGACCTGCTCGAACTGCTCTTCAAAATC
TCTCGGGTTTTCACTAGCATCCACTGGCGGGTTGTTGACCGAAGCGGAAAGTTGCTGGTAAGGCATTTGACGCTTCATACTGGTGTACGCCTGGTTGTTT
CGGCTAAGAAGAGCCTGCATTTCGGCTCGATGCCGGGCAGCCTCCGATACCAAAGCACGCTCATACTCGCTCGATTTCTGCTGTAGGCAACTTTCCAGCG
TTGCAATCcttcgcttctgctcgttTATGACACAACGTGCattctccttgtccttctttGCTTCCGTCTGGAAACAACGACGTGGTGAGCTCCAGTAAAT
GATGATGTCAATATTCTAAGCACTCACCACAACCACCGTGAAATCACTTTTTGCATTGGCATATTTCTGCCGTAAGCGGTCTCTGTCGTTCCGAGTTTCT
CCCACTGTTGTCGAAAAATCAAAGGCGAACTGATGAGCATACGACCCTTCTGAAATTTAACCAAAGCGATGCAAACGGCATGATAACATTTTCGTACCAT
TTGATCTTAGCAAGCCTTGAACGTGTCCAGTAGCTCCAAGGTGTTTGCTCTTCAAGAATGTACTGGGGGTCGCGATATGGTCTCCTGATTCCTCCTCTGA
AAACACCGACTTCAGTACCAGGCCATCCTACGCAGTGCAGCAAGTTTTGCTCAGCAACAGATGCTCAATTTAAAGCAATTGAATGACGTACGGCAAACTT
GATTTCGCCGTTTTCCGATATCTCTTCGGCCTGGAAACCTAGCTCGTTCAGCGTGGCGACAAACCTATTGTTGTATTCAGCGCGCTGACCCTCAAGTTGC
CGCCGCAGGATGCTCAGCTCTTCTTGAAGTCTACGGATGCGACGGTCCTTGTCTGCAATTGTACCATTGATATGGTTTACGCGGGGCTAGTCACACGGAA
TCGCTATGTTAGCTACGATGCGATTTCCGACACTTCGGGAatctacttcgaagtatatGCTTTACCTGGTTCTGTACGGATCGACATCGGTTGGCAAATT
GGAGGGTTCCCAGGCACTCTTCGTAGTGCTCTCTCATCGGGTGAATAGTTGCAATGAGGGTGGTGAAACAATTGCCGCCTATAACACATCAAAGGGAAGT
AGGCCAGATAGCGGTGAAACAATGATACGTATCCACCGTGCAAGTTAGTCGCTCCAGTCAAGTACTACGAACCAATACTGTTCTGGAGGAGTCGGGTAAG
TTTTGAGTCTCGGTACGGGATGTAGTTGTAGCCGCTCTCTGGGTCCAGCGACATAACAACCTTGCCCACAGCACTTAAGCTCGAGTTAATATGCAACGCT
TCCTTCAAGCGCTGGCCGTCCGACTCGCTTTTCTTCAGGCGTTCCGATCTGGAAAACAAGAAGATCAGATAACCCGAAACAGGAACATATGCACAGAGCA
GGAAAATGTTTATGTACCCCGCGAGGTCAACCATGTTCAGCATGCCATAGATCACTTCTTCAGTGTCCCGAACTTCGCGATCCAAAAGCAAAGTACACCG
GTCAAAAGCATGCGAACAAAGGTGACGACAAGCAGATTACTGTTCTGCATTACCTTGCTGAAAGACGTGGATAGTGAAAACTGTGTGTGAGCGTGACGAC
ACCGCGTTCATTTTCGTTTCGTGCGTAGACCGCAGCTTCAGTCCGCACTGCACGATAGCATCCACTTCTTCTCTTGAAGTTACAGTGACCATGGATAGGT
CTTTCACGAAAACTCTGCCTTGGGCATCTTCATGAATTTCAAAGTTTGCTACGAGCATAGAGTTGAGTAAAGTCAGAATGAACGAATAGCTTCGTCCCGG
ATTCAAGATGACGTCTGCGCCTTCTGCCAACCTTTTTCGTAATCGTAGTCTTCTTCTGTTTTTGGCGGGTttgagctgaagctgttctCGGGCACGCGCA
AGGACTCCAGGTGAGACGTGCAACTAAAACTCCAAGGTTTAATGTTTTCTGCTACAAGCATACTATACCTTGCGGCACTCTCAGTCCGAGGAATCTgctt
ctgttgctgctcaaTAAAGTGATACACCAGGCTATTTTATCAATGGCACACCAGTAAGTCGCGATAAACACTCTAACGTACTTGACGAAGAAACCACTCG
GCACTGCTTGACGTCTGGTACGACACCGGCCGACCTGTTTTCTTGAGATAGCTGCATCAAGTATTTGTTACTGAAACACCGGGCGACAAACAAGACAGGC
CACTGAGCTCTCACTTTGACGAAACTTACGCTCGTGCGAGATCGCGGACACGATCGCAGTAAATTTCCAGAAAGCTGACGACAAGAGTCACTTCCTTTTT
AACAAAGGAGGGAGATTCCAGCAATTAGCAACAGCGTGCTTGACAAGGCTACTATGCAGAACTTCACGCACCTTGGATTTGCTCTGTTGTCGATTAACCA
TGTCGAAGAGGAATTCAATTGACCGAGATAGTAGCCCTGCTTTCTCTCCTCCTGGTTCACCAAAGATACTTGCAATAGCAAGAACCAAACAGGTCTACGT
CATTTTCCTCGTTTCCCAGTGAAAAAACGAGAATCTGTGCTTCTAACTGAGCCACATTGGTTTGTTTACCTGAAGGTCTTGCCTGAGCCTGTCTGTCCAT
ACGCAAAGCAGCAACTATTGATGCCCTTCAACGCGTAGTCCACCAAACTCTTACTCGTCTGAACGAAGAATGAAGAGCGTGAACGAACGTAACTTGTCAG
ACCGAGCGATGCCAGATAGCGGTGGGCACAGCATTTCCATGGCGTACCGCGTCGAACAGTGTTTCTTGTGTTGTGTCGGTCCAATAGATCTGTCGTGAGA
AATGCACAACTTCGGTATTTAGTATGGGATTCCAAGTAAGCTCATTCACAGGAGCAAATGTGCGCAGTACgttgtcgaagctgaaggcgtGGTTTCCATA
TTGCATCCGTTCCGTATcctatacatgtacatgtgcACACATACACGCAAATGCGGGCTcaactgcaagaagaagaagacaacCTTGTTTTCATTAGTTC
CGTACCTTGATCACAATGTTGTTTGGAGTCTCCTTCTTCCGCTCGAACATGTCTTCGGGGGCGTTCTGACCGTCAGCACATGGTCTTGCGCGAACATACA
CCTACAGCAATGACACAAACCAAGATGAAGATCGGTTATCAGCAAAACAAGAGCTGTCTCCTTCACGACGTGGGAGAAGCATACCTTGACGTTCGCGTTA
CCGAGCAGCCGAGTGTAATCGGTGGTGACCTTGTGGTCCATAGTGAAGGGGACAGCCCACTCTCTCTCTTCCTAGATTTCAGagagcttcttctcttcTC
TTGGGCACCTTCAGAGCCGTGAGGTATTTTCAGTTAACGTTTCGCCGCACAAGTGCACTTGCTTGCGCCTCTTCACTACGCTGCACGTTGCAACGCCGCC
CGCGATGGGGACCACCACAGCGCCGAACAACTCGGCCGAGCACCTGCACAATGTACTAGCGCATATTCAGAATCTTTGCGCCAAAGCTTCCGAAGATGGC
AACCCCGGCAAGCATCAACAGATTCGCGTTATACATTGGGTGCGCAAACTCCGCAGCCAGTCGACGTCGAACCCCACGTGGCTGAAGAGCGTGCTCGAGT
TTGCCAATGTGTTGCTTCACATGCTTTTGGACGGCGTACGTATGAAGGACGGGGTGGACGGGCAACGTTTTACTGTTGATCAGCTGAATTGTGTGTGTTT
TGTGTCAGGTGATTGAGGAGCCCTTCACTAAAATGCCACCTCAAGGACCGCTGGCAGCACTTCCAAGGTACCAGGTATAAATCCTCTCTGACTAATAGCC
GCAGCGATTCATTGCACACGTAGTCACTGAGTGTGTTTTTCATTTGGTTGAGCCAGGTTGCACGCCTGGCAAAGACTGCAAAGCAGGTCGTCAGAGCACG
GCCAGCACACCCTTCACCAATGGGGGTCCGCATCAATTCTGCAAGAGAAGAACCGCGCAACAACGACTCGGAAGAAAATGCGCAAAGTGTAGCTGCCGTT
CAGAAGATAAGTAAGCAGATCCAGACCCAAGAGCAAGACGATCAGTGGGAATGGCAGCGTGTCTGGAAAGGAGCATTCGACAAGAtgcaccaccagctgc
agctgaagacaGAGGAGACGGGGGCGCTCACGACCGAGAACAAGGTGCGTGCTCTTTCGTCGTCTCTCATTGAACAGGTCCCGGCTAAGTAAGTGCACCG
TCTCTATAGGAGCTGCGTGCACTCGTAGCAGGCCACAAGAAGGCCCTGGAACAGGCTGAGCGCAACCGACGCGAGGTTGAGGCCAAGCACCTCGCCGAGG
TCGAAAACCTGCGAGCTGTGCACTCTCTAGAGCTGTCCGACCTGCAAGCTCGACACCGCCAGAAACTCCAGCAAGTGACGTTGCAGAACGACGAGAAACT
GCTcagcagacgacgagagAGCAACTTCATCCGCCCTGCACTCGGTCCCAACACCTTGGTGCGTTCAGTACAGACCTTGGTTCTGTGTTGTGGCCAATTA
TCTTCTCACCGCAGTTGATTTTCGTACTGCAACAGGCCCGAGACGACCACACCGACAACAACGCGGACTTCCTCCAGTACATCGACGCCTTCTACTCGGC
CACGCTGCACCTCACCGCGCAGAACCGAGTCTGACACGTACGTGGCCGCGCTTGACTTGAATAATGTAAAGCCCTTTAATAAACTCAATACTTAAGTACA
TTCTAATAGTAGCCAAGTACCAGTTTGCGATAATAGAGACAAGAgcgcaccaagcaccaagaGCATGTCAAGCAAAGTTCTCCAGGGAGACCCGCGCCGC
CCCGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCGGACGAGGCCCCCGGCGACTGGtacgccttcttctcgctcgtgctgggctTCCTCGCCT
TCACCATGAAGGTATGTATCATCACCTCTTGTCTGgaatccccccccccccccccNCCCCCCTCTCAGTGAACGAAGCTAACTAGTCCATCTCTTTTGTG
TGTACTTTGCAgtggaaggagctggccTGGGGCtccctgctgctgtgcgtggGCTCCTTCACCAACATGAAGTCGCAGGACATGAACACGACGCAGGTGG
CcatgtccttcttcttctccagctcggcccTCGTGTCCGCCTACATGGGCGCCATGCGTCCGGGCATGCCCATGCCCCCGTCGGCTGAAGCCCCCGCTTC
ATAGAGAGGGTGAAACCTATAGGGAGAGTATAcccagcagacgcagaggTGATGGAAGGAGGCACCTACCTGGTATCTGGCTGCTGTAAGAATGGA