Description :
From Genome Similarity Track
Location :
Scaffold_3322:1445- 2567
Sequence
1122 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTTCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACGATTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGA
AAGTTCAGCAGAACACGGATCATCGGGGGCCCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGCAGATTTTGCTGAT
CCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTTCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGA
AGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAG
GTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAA
AACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAAAAATGAGAAA
GAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTC
GAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGGACCGG
TGAGAGCACCAACGAACACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGA
GGATATCTTCGAGCTAGATCTG