Description :
From Genome Similarity Track
Location :
Scaffold_642:14447- 15537
Transcript NameFunction/comments
Phymu_g11315hypothetical protein PHYSODRAFT_314178

Sequence
1090 bases(100 bases per row)
CTGACGCATCATGACGGGTAGCGAACTTGAAACTGGTTGGTTGTTCCCTACGCAATCAATTGCGATGTGAAGGCTTTTAAACTGACGGCAGTGAGCAAGG
ACAAGCCCCCGGACCGCCGATCCGGCAAGGATACCGGTATCCGGGTGATCGCTGTGTCTTTGCCGCGGACGACCAAGAGAGACCGTGGCTTGTGCAGGCA
ATCTCTGTGTAATTTGGGAGGCACGTTGTATCCCACTATCGTCGCGACTCGAAGGCGTCGCAGATGCCCCGGAGTGGCATAGTAGTTGCAGTCAACACCA
ACGAAAGCGGCTTTGAGCAACACCTGCGTCTTCTGTCCGATGGAAATTGTTTCGTGCGCACTGCGCATGGAGCACGTCCCAGAGTGGCGTGGAAGTGTTG
GAAACCGCCAACTCCAGGACTTTTACGGCTTCGGACCTGCCACAGATTCGGCGACAGGAAACAGCCGATCCGAGGTGTCATCATCGCGGGGAAAGATCGG
CTGGTTGAAGCAACTTCAGATATCCTCTCCGTAGTGATAGATGCATCAATATAACTACATGGAGGAAACTAAATATATTGCAAACGAAGAATTAGAATTA
AAATAATAGGGGGAGTCAAAGTTGGCGTCTATTCCATTGAAATAGATACGACAGAGGCTGTATGAGTTCTCACAGGTAACGGCTTCGACAGAAAAAACCA
GCTGCGTCCCTCTCTtctgtggtggtggcgccgGTTGTAGTCGCTGTAGTTGCAGCCTGTCCAGAGACGCCGGCAACGGCGAGGGcggcgatgacgagga
cctggaagaacttcatggttGTGAGTTGTAGAGTTGGGATGGAGACTTGGGCTCTTGCATCTCCGGTCTTCTCAAACACGTACCCCGGCAACCTGCGGCT
CAACCACTTCTAAATCTTTCAAACTAAAAGTCGCGCGACCTGACAGGCAGACTGCTATCTACAGATGCCGGTTATACCTACAGATGTCTCCTGATTTAAT
TTTGAGTTCtctaataaaatatgagtttCGTACGTAGCCCAAAATCGGTTTCGCGATATAAAACCAAAACAAAATTTTTAATTGGAAATT