Description :
From Genome Similarity Track
Location :
Scaffold_29:1444460- 1447216
Sequence
2756 bases(100 bases per row)
GCCCACCTGGGCTGTGTGAAACTATGCTACCCACCTTTGGTGCGAAACAGTGTTACCCGCCTTGATGTGTGGAGCTCTGTTACCCACACCGAAGCGCATA
CAGCGACTTCCTTATCACTAATGGTCTGAGTGACTTTGCGTAAAACTCTGTTACCCACGCTCGGAGCCCCAAATGTCGGTCTCCATAAGCAGTTTCGCTG
CTTGCGGAACTAGTTATCCGCAGTGTGGACTTGTGTTACCCACCCGGGAATGCCCTTCTGCACCACCACTGTTGAAGCGCATACGGCGCGATGAACTTCG
GTTTGAGATCAGCTCGCGTGGCAGACGCGCGCACACACCGGGCAGAGCTGGTGTCCACCGACGGAGTCAGAGAAGGCCGGGCCCTAGACTCCGAGTAGCA
TGAACCGACGTCGGCCTGAACAAGGTTCAGACCCGACTTGCGGCGGTTAACGTGACGTGGCACTTTGTTATCCACGTCGTGATGTCTCGTTGACGACATC
AGAGGCACTCGAAACCTCGTGTGGCACTGTGTCACCCACACAGGAAGCATATCTAGCGTCTTCCTCTTCCGTTAAGGTCTAGGCAGCCGTGTGGTACTGT
GTTACCCACACTGAAAGCGCATGCAGCCTTCCTCTTCAGTAAAGGCCTGGGCGACAGTGTGGTCCTAAGTTACCCACCTGGTTAGCGCTTAAAGGCATAA
CCGTTGTCGACCCCGTACGGCGCGACAACCTTCGGCGTTGGACGCTGCTGGTGTAGCAGGTCTACACGCCGCGCAAAAGACCCATGCTCTTGGCATTGTC
GCAGCGGAGCATTGGCTTGCTGTATGCAGAGCTGTCGGCGCGTTGACAGCTCCGTGACGATTCTGCGTCATGGCGGTCTGAATAAGACATTCCAGTCATG
ACGGAGGTGGGAACATGACCCACCACTGCTCCGCCATGGACCTGGTCTTTTAGACCCTTATCAGCCTTGCCACACGAAAGTCCTAGCTGTGCCTTGTGTT
CGACACAGCCATGTTGTTCATGCGAGAATTGTTAGCGGCACCGCGGTGCGCGAGTTCCATAAACCCAAACGTTCAGGTCCGTTAAGGACGAAGGATACTT
CCTTCACCGTGCCAAAGGCAAGTCCACCAAGGACCAGCCCACGACTGCCACTCTGGCATAGATCGTAGTCGAGTGTCGCTATGCCAAGCGACGTTCCGGC
GGCGTATCAGAACTCATCAAACGTTCAAAGGGTACCGTACTCCCGTACACCGAGTGTGCTACCAGCCGCCCATCCCTGCCATTCACCGGTTTGAGAGAAC
TACGTGTGGAGTAGTTATTTACTCCAGAGTTGCGGATAATAGCCCGTCGACAAAGATGCACCGCCCAAGATGTTCAAGCGACGAACCCTCGGTCGCGTGA
TGTACCGTGACTCCAAGTTGCAAGAGACTCGACGATGTCACTACCGAGCACTTAGCGATTATTGGAAAGGGTCCAGATGTCACTCGATCAAGGCCGTCCT
TATTATTAATAATGGACTGGCTGGATTTGCATTCAGCGGCCAAGAACTGACCATCTACGGTACGAACCCTCGGTGGCGGTTGGGATGAGTTCGCGGAAGA
TTCCGCGATTCTTTGAAGGCACGTTCACCGTCTCGGACAGGGCTCGAGCTGTTGAAGATGCTCATGCGACGGTGCAGACGACGATTGGTGTGCAAGAAAA
TCCATAACGGATCATTGTTCACTTGATAGTTTGTAAACATGATTAGTACATCTAATTAGGAATAGGCCCGAAAGGGCAAACATAAATATAGAACAGAATT
TCCACTCAAGCACACAGAGCGACGGCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAGCTCGAAGCTTTGTAGC
AGGGCTCATCCGGCAAGGCCAAGAGACTGTGTGTGTATTGGCCGATTACTATCGGGAGGGTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGG
AGTGCTTGTATTGCATCCCTTTTATTCTTCTAACCGAGTGTTGAACACTCGGTGCCCTCGTAAAAGGCTTACCCGTGCATGGTACCCTTCCACTGTTGAG
ACCACGAGGATCCATAACACCTATTAGCTTTGCTCGTGCTCGTTGCGTGTCCTTATTTTTACTAGTTGGCCTATATAAGTAGTTTATAAGGTCCATTCTG
TCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCTTTGCTATTCTAGCAGACGTATTGTTGTGGGAACGTCCTAGCTACATTTGAAGCTAGAGT
TCACGTGGGAATCCCAACACCACAGTATAAACATCCGTTTCGAAGGCAACGTGGATCTGGTGGTGACTCACACGAAGCTGCTGGAGTGCTACCCTTTCGA
CAGTGTCTACGGGCTCACCAGCTTCATGTCCATGGTCGAAATGGACAAGATCCTCATCATAAATCATGTCGAGTGCTCAGCGTCCGAATCTTATGCGCTC
GGGTCTGCTGTAGATAGCTGTGCGCTCCACGTTCTACTCGGCTTCGAGCCCGAAGTTTGCCAGCTCGACGGTCGTCCGTTCCATCCGCACGTTGTACAAG
CGCATGACTGCCCGTAATGGGTCTCGTCGGCTGTCACGACCACGAGCAGCACGATCGCCACCACCACCACGACGCCCAACGTGTCTGACACGCTGCTGGA
GGGCTTTTATGACTCGACGGATCTTGATCGAGCTCGACTGAAATGGGTTCAAAAAC