Description :
From Genome Similarity Track
Location :
Scaffold_2:144403- 151689
Transcript NameFunction/comments
Phyci_297964Hypothetical protein
Phyci_88970serine protease family S10, putative

Sequence
7286 bases(100 bases per row)
GCGCCACCAATTGAACGCGCTTCAGCCCGATCCACACGGCTTCGATATTTTTTTCGTGTCCTTGCCGGTGTGTATCGGCAATGGCAGGTGTGTTCTCACT
TGCCTCGGTCTCCGCTTGGCTTTGCCTCGGCTTGGGCCGTCTCCACGTCGAAGTACACGTAACGCGGCAACTTCTCTTCAAACGCATTACACTCTTTACT
AGCACCTCGAACCACAGCTGCCCGGCCGCCAAGCGAGCTCATCGCCGGCCGGCCGATTGACTGCCGCGGCGCTGGTGCAGCTTCTTTTCGCCGCCGGTCA
TCCGTTCCAAGTTGAAACCACGCGAGCTTTTCCCTCAGGTTTTTGTCCAATACCCGGAGACCAGCGAGAAGAACAGCGGACGATACCTACGGCGAGACCA
GCGCGTCCACAGTCTCCACCCAAAGCCTCCTCACTCTGAAGCGACCCTCGTCCAGTCGCAGACAGACTCGCGCCGCCCAACAGGCTGCTGGCAGCTCGCC
CCCATTCGCCGCTCTCGCAGGCCCCACTTTCCCGCCAATCGATGCAGCAGCAGCGCCGACAGACCGGGAGATCGGGCGACGGCGGGGCGCCCCACCGCTC
CCGCTCGCTGGTGAACCCATACGCGACGTCCTACCAACAGCAGCAGCCGCAGTCGAGCTTTTTGCAGTACTCGATGCCCGTGGACTCGCCATCAATTCGG
AGCTTCAACCAGCCGCAGCAGCCCCCACCGCATATGCCCGGGCGTTATTGGCAAGCGCCCACTGGCGTCGAGGCGTCGACATTGAGCTCCGGTAAGCAGA
GTCGTCACGCCGGCAGTTTGGACTTGGACGAGTTTGGGGACATCCTGGACACCAACTCGGCTCGCAGCGGGGGCGACGCAGCGGCAGCAGGAGCCCCGTC
GGAAGCAGCGTCGGAGATGAGTATGGGCAGCTTCGACGCCCACTCGTTCAATGATGGCATGGCGGGGTCGACAGGCGGGTCGGGCGTGGACGCCGCTGGA
TTCCAGTCTGCACCATTGACGACAGGGTCCCCAGCTCCAGACGCTGAGGAGAACAAGGCGCCGACGAGGGTTATTCCAGCTTCTGCAGACCCACATATGA
TGGCTCTAGTGGACGCTGCATACATGCCATTCAGCAACTCGTCCAGCGAGCCCGATCTGACGACCGAAAAACTCTCCAAGGACAATAGCGAGAGGTGCCA
GTTCCATGACTGCCCGAACCGAGCTCGAGTGTCGCAATCGTACGGCAACTTCTGCAATCGTCACGTGATAGTCGCGCCCTGTGGTTTTCCTGGTTGTCGG
GACAAGGCCATGGAGAGGGCTGCAATGTGCGTGAAGCACATGGAGCTCGGGAAGGAAGCGCTGAAAGCCATCCTGGATGCTCGTACGCAAAATGTGCCGG
TGTGCAAAATGTCTGGCTGCTTCAAGAATGACCAAGGCCGAGGGTATTGCCGCGGCCACGAGAAATTGTTGATGGCCACCGGACGCCTGCCGGCGCACAT
CAACAAACGCCGACTCAATAGTGCTTACACCATGTGCAGCTATCCAGAGTGTAGCAAGCACTCGCAGCGACATCATTTGTGCCGAACCCATGGAAATCTG
ATCATCAAGCAAGCCCAGGAGCTGGCCGACAGACCAGATGCGCCGGAAAGTTACGAAGAAATTCTCAGCAGGATGCAAAAAGATATACGACGTTGTACGC
ACGAGAACTGCACCAAAAACTCTCAGCGAGATCGTCTGTGCACGGTGCACTATTACGAGAAGCATAAACTGCAAAAGGATGTATCTGCAACGCCAAATGC
TGCCTTCGGTGGAACATCATCAAAAGAAAATATCGATTCAATGCAGCTAGGACCAGGAGGCCGTGGTGACGGAGACATCCGCGCTGTTGAGCGGACTCGT
TGTGAAAAATCTGGCTGCAGAAATTTGTCGTACGCTGCGGGATTGTGTGTCGAGCATACCAAGGAAAGCCAAAATCTGATCTCGAGTCAAGGGCGGTATG
GTGATCCATTTTCCTCTGGGGGGAATCGTGGCATCTTCTCGACTGACATGGAAAATGACACAGAACAGGGTTCGTTTATCCAAAGCAGGAAATCGCCAGC
TATTACTCCTCCCGCCCCAACGAGCCTAGTCATGTTGACAGATACTGTCCACACTAAATGCACGAATCTAATGTGCGATCGTGAAAGTTACGGGCGCGAT
TACTGCGAGGCATGCCAGAGACTCTTCTCGCCTCTCGTGGTAGCCATTAATCAAGACACAGCCTATCCGTTCAATAATTCGAGTGCAGCCGTTGCTCAAG
CTGAAGAGGGGGCGTTGACGTGTCGTGTAAGCAATTGCGGGCAAGACTGCGCTCGCGGTGGACTATGCGCAACGCATCTTCGTGCCTTCAAAACGGGCTC
GTTGTCCGTGGATAACTTGAAACTGGACTCCCAGGCACAGCAGCATCAGCGTGAGCAGGAACTGGCTGAGGCTGCGGCGGTCGCTGCTGCAGCGGTAGAA
GCAAAACAAGCAAGCCCCTCTGCGCCCGGCAAGTCGAGAAAATATTACTGCAAAGTTGATGGGTGCGATAAGCAGGCTCAGAAACGGAACTTGTGCAAGC
GTCACTTTCGCCAGTATGAGGGCGCCCCCGCAGGAAAGCCGCAACCGGAAAATAGGCCGAACGGTTCGGCGAGAAGCTATACACCTCGCGCCCAGCAATC
TGAACTCCCTCAGCCAACTATAGCGTGTCGCTTTCCCGGGTGCTCGCAAATCGCGCGCGGTGGTTCTCTTTTGTGCTTGACGCACTCTAAGGCGACATTT
TGTTGGCAGCCAGGATGTGAAACCATCGTTGATCGCCAGCGCTTCTGTGAGTTCCATGCATTCCGACAGCAGTGCGCATACGAAGGCTGCATGTACACGG
CCGAACGAGATAGCAGTGGCTGCTTGAACCACGTACTGGAGCGACGGTGTCGTCACGAGTTTTGCGAGAAGTTTGCAGTGGGCTCAAACAGTGATTGGTG
CCGCCTGCACCAGATAAGTTGCCAGGATTCTCCCTGTGCCCTGTGCAAATTGCACGCGCTATCTCTGGATGGGCTTGCAGCCAGCGAAAACGAGAATAGC
AACCGGAGTCGCTACACTGCGGGCATCTCGGCGTCAAAAGGAATGCCGAGTGCAATCGGCGGATTTAGTGGCGGCAGCACGTTCGGCCGCAACCCGCGAT
TGATGTAGGTGTGGATGCAGTCAACGCTTTGAGCTCTTGCTTGGAAATTGACAATGCGGTAGTGATAATCGGAGGACGGCAGGCACTGCAGCTAAGATAG
GGCTGGACTGACAAGCTACGTTGTATTAATACATGAAAAATAAAAAAAGTAAAAGCTTGCACCTCGTTGTTGCTCTTTGCCGTACATGCCACATCAGTGA
TGTGACGTCACGCACGTTTCGACACTTCATTTTTCCACCAAGATTTGCAAGAAAAACGAACAAAAACTGCCCTTTACCGGTGCAAAACAGTATGCACCGG
TAATTTCAGTAGATCCAACGGTACCCGGGAGTAACAACCAGGTAGCCACTGTTCGTGAAATTCCGCCGAGCTTCAACTCGCCGCCAGTCGACGCGATCGG
CATCGGAGCCCGAGACCGCGGGCGAAGATGGAGCGCATCTACTCGGCCTTCTTCACGTCGGAGCGGCGCCGCGAGCCGCAGGAGCTCACGGCCGCGGCGC
TAGAGCTGCACAACGAGACACAGAGGACGCACAAGCCGCAGCTCCCGCGTCCAGGGGCCGATGGAGGCAGGCGACGGCCCGACGCCGATGCAGAGGAGTC
CACGACCGACGCCAAGCGCCACGCGGCCGCCCGGCGCCAGGATCTCCGCCAGCTGACGATGGACTGGGCCAGCGTCAAGAAAGACCTCGAGGCCGCGTGC
CAAGCGGCGGCAAGAGCGTTCCTATTGGCGTACGGGGCCAAAGCCTTCACCGCCGTGCTCCTGGCCTCGAGGAAGTGGAGCAGCCTCGAGTACGGCTATG
CCGATGCCGCCAGGCTGCTGCTGAGAGGCGACACGCTCCGCTTCGGCGCCTTCTTCGGGAGCTTGGTGGGGATCTTTCGGGTCACGGAGCTCGTGGCTCG
AGCTGCGCGGGGCGGACAGAGAGACGCTGTCAACTTGGCGGTCGCAGGAGCTGTTTCCGGGTCCGCGCTGCTGCTGGACTCGCCCTCGAGGCGCAACACC
ATCTCGCTGTACATCTTCGTACGCATGCTGGACGTGGTGTGTCGCCATTTCATGTCGATCGGTGTCTTGCCCACGTGGCGCTACTCGTCGGAGATGCTCT
TCGCCGCTAGTAATGCCGCCATTATGTATGCGTTTGTCGTGGACCCGAGTTTGTTGCCAAAGGTAATGTACCTTTTTCGGGGCGGTGTCCATGGGTCCGA
TACTGCTTCTTGGTGCGTTGACGTTGGTACTTCATGTGTATGTTGTAGGGTTATTACCAGTGGATTTGCCGCATCGGCGCTGTTAACCACCACGGTTTGG
AATACACCGTGCGTCAGCGTATGCGCGGTCAATTGGATGCGCACGGAAATCCGCTGCCGTTTCGCTTGTGCCAACCGCACTACCACATGTATGCAACTGC
TAGCTTGAGTGCAAGTGGGCTGGTGTCACGAGACTGACTGCCGTGTTGTCGTGGCAATCGTTGTATTAGGGAGTCATGCGTGACGCATTCCATCAAGGAG
TGGGTGAACGGCTTGGGGCGGTCGATGCAGATTTACCTGCCTGTGCACTTCCTCCCCGCCATTTTCTTCCGCTTCCAGCAGCTTCAAGGAGCCCCTGTGT
CTACAACTGCACGTATTTCCTACGCGGCGCTTTGCTCATCAGCGTTTCTTACGTCGTACCAGGTTCGTTTATGCTTGACGCTGATGGAAGCTATACCTTG
TTTGGATGCTGACTGTTGATGCGCGTGCTCAGACTGTTGTGAAGCTGGTTATTTGTACCGCTCGCAATGCCTTCCACCGAGACTTTGCCGCAACGTCACT
AGCTGCCGGAGTAAGTCACTAGTCATCGTGTGTCGGATCGCTCTTGGTCAACTCACGCGTTTGTGTTAATCAGCTGGCAACAGGTGGTGCATTGTTCTTC
GAGCACACGAAGCGCCGTTTTGAGCTGATGCTGTACTGTTTCCCACGCGCGCTCGACATCGTGTGGCAACTTTTGAAACGCCGTGGTCTCGTGCGCTACG
TGAAGCACAGTGAGGTAGTGCTGTTTTGCCTCTCGATGTCGCTCATTATGTCGAGTCCGGCACGACATTTCAAGCCGACGTACCTCCGGATTCTGCGTTT
CATTTTTGGCGGGGACATCATCTAGTCCAGCTCACCTGTGTCCTAACTACTTCGTGCAGCGCTCCTGTGCAAGATAAACGATTGTTTTTTTTAATGAAAT
TGCTTCAATGAAAGCTATGCACGCAAGTTTTGCCACCGGGGCATTGACGTTTTGATAACTCACTCACTTCCGACTTTCATTTGAACATTAGCGCTAATTC
GCGACAACCTTTAGTACTCCAAGTCGTTGAGCACAAACAATTCAAGCATTTGCATAGCCTCCTCAGGCTGCGTCATAGGCACGAGATGGCCAGCTCCCTT
GACGGTCACGTACGAAAGCCCCTGGAAAGCCTCCACGAACCCACCCGTCTGCTTCGCCTCTTTTTCGCCATAAGTCCAAGCCTCTCGCGGCGCCAGGCGC
GGAAGACCCAATGACTCCACCGCCCAAAGACCGCCTACAACGTTACATACCAAGTCTGCGTCGCCGTGGTAGATCACACCTTTCACTCCGCTCTTGAGCA
ACTCACGCCATAATGGCGTCACCTCAGCGTTCAGGGTCGGCGTGTACTTCAACATCTGCGTGTGTTGCAGCATAGGATGATCAACGCCCAGGATGGAGCC
AAGCGTTTCCATAGTTGCAGTGGTCAACGCGTCACCGCTCCAGTGCGCTAGTGCTGGGTTCGCATGCATCGCAGCGCGAACTTCAGCTAGGTTAAAATAC
GATTCGAGGTGAGTCGTGTCCAGACACAGATCCATCGTGTTTCCAATCGGGTGCGGCAGTTTGCCCGGCGTCGACGGCGATAAGATCTCCTTCACCAGGC
GTTGAACGTCGTCCTTAGGCGAGCCAGCACATGAGCTATACACGTCGTACATATTGATGCGGTCATAGACCAGAGTCGTCAAAATGTCCAACGTGGCGGA
AGTGCACTCCGGGCTAGTAGCGTCGTCGCTCAGACCAGGAGCGGCAATGGGGCTCTTCTCAAATTCGTGGAGGTCGGGGCAGCTGGCTCGGTACTTCTGG
TACTTCTCTGTGCTGAGAAGTCCATGGTAGTAGGCGAACATGGCGGTCGAGAGACCCATAAACTCGTTCACGCCATTCCCCACCACGAACTTCTTGAGGT
TAATGTGGTTCACCTTCTCGGGTGTAGCTGCGTTCCCTTCCACAATGGCTAGCGCCGTAGTCGGCACATAAACTCCGCCGTAACTCTCTCCAGAGATGAC
GAAGTCGTTCTCCCTTAGCCAGGGAAACTTCCCAAAGAATTTCTGCAGAGCGTCGTACAGATCCCGAGCCTGCGATACGTCATCGGCCTCGTAGACCCCA
CTGGAGTTGTAGCTGAACCCGACGCCCACCGGCGACTCGATGCACAGCAGGTTGGCGCGTTGGTTCCAAGCAAATTTGTTGGTGCGGAGCGTTCTGCCGT
CCTTATTGACCAGCAGCGGCCCGTTCTCCGAGAAGCAGCCGGACAGCGAGCTGGACCCCGGTCCTCCATTGAGCCACAGCAGCACGGGGTCCGTCTGGGG
CGTGGCACTCTGCGACTCAGCCAGGAAGTAGAAGGCGTGGCCCCCGTTGTTCAGCGGCAAGTACCCGGAGAAGAGCCGCGCGGCGTAGTCGCCGGGCTTG
CCCGCCAGCGTCAGGACCTCGTCCGCGGAGCCGGGGAAGGGCTCGCCGGGCAGGTCGGGCGTCTCCGCGTCGGCCGAGTCCTCCATGACGGTGGGCTCGG
GCGTGCGCTCGCCCGTGCGGATGAGGTTCTCGGTCTGCAGCGAGCGCTGCAGCGTGACCATGAGGTCCCCCACAGCCAGGAACAGGAGGCAGGCGACGCC
GTAGCGGACGAAGCGCCGGCCCGTCGAGGACAGCAGGCGGCGCGAGTGCCCCGCGGCCGGCAGCGTCTGGCGGGAGCGCAGCCCGCGCGTGAGCGGCAGC
GTCTCGTTCAGCGGGTCCGAGCGCAGGTACATCGGAATCAGGTCGATCGTCGAATCTCGGGACTGCAGATACGGAAGTGATGCTCG