Description :
From Genome Similarity Track
Location :
Scaffold_3385:1444- 2560
Sequence
1116 bases(100 bases per row)
CAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCAGCGGCCAGATCCAC
GATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCC
CACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGAAAA
GTTCAGCAGAACACGGATCATCGGAAGATCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCC
CGCTACACCACAATGGTGCGCGTGCCCGGATCTTTCGGTGACTCGAGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAG
AGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAGTGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGT
GGATACGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGTGAATCTTGACTTGCGTCAAGATCCGCTAACAAAA
CAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCAGTTAAGCCAACACCGTACCGAAAACCAAGCCCGCTAGTCGAAGAAAAGAGAAAGA
AGACGAAAACAAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCCAGCTGGTCCGACAAGGATCTCGA
GTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGACAGATCGAAGACCCAAGGGAACCGGTG
AGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAATTATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCAACGCAGAGG
ATATCTTCGAGCGAAA