Description :
From Genome Similarity Track
Location :
Scaffold_413:14438- 15496
Sequence
1058 bases(100 bases per row)
CAATACCGCCCGGACCCCGGAGTTGCGCATCCGTAAACTGACACCGTGCCGCAGGGTGACCCAAGTTTCCACACTGTAAACATTGAAAACGTCGACCGAT
GTCCGAGTGCTTGATAATGATCGGTGTCACGAACCAAAGAAGTCGCACAATCCCTTGGAGAAAAGTGGGTTATCCCGCCAGGAAAAAGGTGACCTTCCAA
ACCGTAGACGTCCTGGAGGTGGGAGTGCACGTATCCATATACTCCAGCTCAAAAGCGGTGTGAATTTTGGAGCGGAAACAAGATGCGATGCGCCCAATCT
CATTGAACCGTGTCACATTATGGAGAAATATAGAGTATTCAGTGCGGGAGTGCCCCGAACGACCGTCAGGTCCCCGTTGATTTAGCCAAATGGATCCCCG
TCCCGGCACGTGTACATTCTAGAGAGTGTACACACGCCCTTAAAAAGTATGCGGACATCCTGAACCTTGCGTGCTACTGCCCTTGAGAAAAGTAAAAATG
AATTATCCGGGATGAGCGGGTGTAGCTGATAACTTTTGTAAGCCCAAGTAAGCGATGAAGCTCAGGCAGGCATACCTGCAGCCGCTCCGCTGATTCCAGA
ATCATTTCCGTGATTCCGTTTGAGGTCTGCCGGCCATTCGGAATGGGACGCCCTCTGCTTAGAGTGAGGAAGAGTTGCCCTTCCACCTGAGCCTGGATGG
TGCTATACAGCCGAAGACGTCCTCCACTGTCTAGGACGGATCGGAGAAAGTCCGGCATCCGGCGACACGCGATGTGCCCTTCTGCTAGTCTCACGATGAT
TCGCCATTCCTCATCCGTGCCCCCCCCCCGTAATCGTTGGGCGCGGACGGATCTGAGCCGTGCGGTACATAAAGTCCTGAGTTTAGTAGCCACTTCAACC
GAAATTCGGCTGGGTCAAACATAAACTCCTCATACACCAGAGCAGGGGACCCCGCCAAGTCTTCCGTGACGTTTGCCTCTCCTTGGCGCACTACCCGTGC
CCACTGGTTGGGAACCGGCTCCGTGGTCTATTTGTGTAGACTGGCCACTTTCCTGATG