Description :
From Genome Similarity Track
Location :
contig_86:144321- 148851
Transcript NameFunction/comments
g12912.t1hypothetical protein

Sequence
4530 bases(100 bases per row)
TAAAGCAAAGAGTTCTCCAGTGCAGAGGGTGAGTCCGTACATCGTGAGGCTACGCTGAAAAAAAGTCTTCAATCGAGCGTCTTAGTGCATGCTTCCACAG
ACACCGACATCCAATTTGTTGGTATAAAGTCCAGGACCTGGTACGACGACAACGAAGCATTGCCTCGCTGTATCCAAGAGAATGGGCCGGAATTTTTTTT
TGTGCTTCTAGAAGAAGAGTTTGTGTAAGTGTTGAATTCGTTGGTTCACTACAGTGAGGTGTACAACAACTAAGAGAAAGTAAATGGTCCATTACATTGT
TCAGATACGAGCGATTGACTTTGCTGTTTTTACTGCTGAAGTCCCCAGACATAGTTCGCGAACGACATGTGGCCGATTGCCCAGCCACCGAAGAGCCCCT
TAGCTCCGGGTTCTTTTTCGTCCATGCCCGCTCCAGCAGCGACAACAAACGGCATGAAGTGGTCGGGCGTTGGGTGAGCGAACCTCACTCCAGGAGCATC
CCGCCAGTTCGTGATCTGCTTCGTGCGCTCAGAGAGAATCAGCTTGGACTCGGAGGCCATCGTGCTGTCCAGCCAGCTTTGAAAAGTTCTCGCTTCCCTC
CACGAGAGCAGAGCTAGAGCTACGGAGACCGCGGAGGTTATGCGTCGACTGCCCCGAGCAAATGATCAGCGTGTCTTCGTCACGAAAAGGTGCCAGCGCC
TGGCCCAGGCCGAAGTGAGTCTGGTTATCCAAGTACGAGTTGATGGACATGGTGACGATCGGGATGTCAGCCTGGGGGCGGATAAACCTCAAAGGCACGA
AGACTCCGTGGTCGAAACCTCGGTTCACGAGTTTGGCCTTGATGTCGTTCTTCTCGAGCTGATCCTTGACCTTCTGGGCGAAAGCAGGGTCCCCCTTGGC
GGGGTAGACCACCTCGTAGGCCTCGTCGGGGAACCCGTAGTAGTCGTAGATCATGTCGGGTTTGGTGGCGTTGGAGATCTCGAAGCCGCTACTGTCCGAC
TCGAAGTGCGCCGACACGAACAGGATTCGCTTGGGCAGGTTCTCGCCCTTGGGGTACAGCTTCTCGAACAGACCCGAGAGCAGCTCTACCGCCGCCGCAG
AGTCTCGCTTCACATTGTTGAAGTCGGAGGAGAGCAACCACAGCGGACCAGGTCCGTGCGAAACGGCGACTGTGGGGTGGCGGAAGGGGGGCATCGTGGA
GACTGGGCGGACTTATTGGGGTGGAAGCAAATTGCTCAATGAGACTGCATGGAGGGCATCAACTCAGCATGTGAAGCGATAGCGAGACAAACCACCAGGA
TGGAGGAAGTTCTTGAGTAGTAGAGCTGCTGACTTTGACGAAATGAAAAAATATTTTTAAAAAAATCTGTTCTCAAAAGACTGCATTACAGTTATAAAGT
CTGACGAGTCAAATATCCTAAAAGATGGCGTAATCTGGCTTAAAAAAAAAATGGACACGTCAACCGCGAAAAGGGGAGGTTAGGTGTACAAAAATGGCGG
GAATTGGGTGAGGAGTAGCCAATGATCTGGCGTAATCGGTGATATTACATTTTACAGCTCGCAAAAGAAGGGAAATTCGAATTCTACACTTTTCTGCTGG
CACTGCCAGTCAACGAACTACCATGGGACCAAAATATATCCGACCTCCGACCTTTCCGACCATGTATAGAAAATAGTATGCAATACAAAAGTTGAGTGAC
CCTGTAAAAATATTCGTAAAAAGGTAAATACGTGTTTTGAAATGGATGGCACTGAGCCCACGTGCCCTGCGCAAATCCGTCGACGCGTGTCAGTGCCCGA
GTGACCATCCTGGAGGATGAATTGAGGGAGGTGTGCCGAGCATCGGTGCACTGAAGAGGGTTGTCGCTGCCACGAAGAACTGTGGTTGGTTAATGCTCCC
TCGGGCACTCCAACGAGTATACCCTGCGCTGAGTTGTACTAACCCCACCTTAGTAGCTCAGTGGTAGAGCCCCCGAAAGGGATGGTCGTTGGGTCCGATT
CCCACCTAAGGTATTTCTAATGTTCGACAGCATATTGGCCGGTGCAAGGCAGCGAGTGCGAGCCTATGTGTGGAAGTATGTGTCGATGTGTGACAGTACA
TGTGTTGCGTTGTGAAGCAGTGTGTGTGTGTGTGAACTAACGTGTATTATGCAATTTAAAGTGCTGGCATATTTACGCACGAATCGGTTCCAATATGTTC
TGCGTGTAACCAGGGGCAGGGTCTTGGATGGCAGGTGTCTGGAGAAGCTGTTCGTGGCGCCCAATATTGGTGTTGAGTGTTCCAGCACGATGGAGTATGC
GTAGGTGCTTGAGGACGGCTCCGGATCCACGGGAGCTGATGTTATGCTCACCAAGGAACGCGAGAACAGACTCCTCCGCGCGAGCTCCGAGCGACAGTAC
CTGATCGCGATAGTTCGGTGCAGTTGGATCAAGCACAAAGCCGTCCTCCAAGAAAAGCTTCATGTACGCGACAAGTTGCTTGGCATCGGACTTCTGCTGC
TTCGAGATCGGTGCCCGCCACATCCGTGGTTCATGAGCGTACCACGCGTACCAGGTCGCGCGAAGGTGAGTCACTGCTGATCTGCGCTGTTTCTTCTTGA
CGTTACTGATGTCGCTTGTGTCGGTGTCTGGCTTGTGTCGTTTGCGTGTAGCATGGCTAGGATTGTTGTTTAGCTTAGCCTCGAGGGCATCCATGCGAGC
ATCTTGCCGCTTGACGTGCTGGATAAAATGATTAATGACAGCCGCTTGGTGGTCGATGATCTTCTGTTCTGCGCTTGGCTCCATCAGCTGCTTGGATACC
ACGATCTGCTGTTGCTGGTGTGTGCTTTGTGACTTGGTGTCTTCACAGGTTAGCTGTGGGGCTTGCAAGATGCGACGACCACGCCAGTAACTCAGAGAGC
GAGCAGCCGGTGTCAGCTACACAGCCTTCAATGCGCTTGACAGCAGGTGCTTCAGCGTTCAAGTCTTTCAACAGCAGATAGTGCCGAAGCACACTCGAGG
TAAGCACATCCAGAACTGCTTGATTCACGTTGTGTCGTGTGGTTTCGAGATGGTGACAGGTCGTGAACAGACGGCGCTGGAAGCTAGCGACCATCGCCCT
AGTTTGTGTGTCGAACGTTGTCAAGTTTTGGAGCGACACCTTTGCCTCAGCGCTATGTCCACTGAGTATCTTGCTAACCTTGTGATATTCCTTGCTGGTA
GTTGAGCCCCTTGTTTGTTGTGCTCATATTCCAGGCACCTCTGTCGAAAATCCACCGCGCCGTGAGCTCCCCGCTCCCATTGGCATGCTGTGCACCGCCG
CGTCTGAAGGAAGGAGACGTCAGCGCAACCTTGACTCCTGCGGCTGCAGCAATTCGGTTCAGCAACCGGTTCACGTGGGAGTAGATGGCGGGCGTCGTCT
CCGCCCCAGCAGTCGACGGTGCATCAAGACCTGTGGTGTCTGTAGGATGATTGAGGATCTCGAGCAGCGGGACATCTGGGGAAAGCGAGATCGCGGCTTG
GCCAGGCAGCTCCGGCAGGTTGTCGATGACGTCGGGAGATGGAGCGGTCTGCATCATCAGGGCCAATGCTATCGCGAGCATTGGGCACGTCGTGAAGTCC
GTTCCGGGGAAAAGCGACAAGCCCTGCTCTTCGGATGTCTTCATGCGAATGAAGCGCACGAAGAGCACATTTCCAGCGTCGATGGAGACATTGGGCTTGC
GGAGGAGCGCGAGATCTGAAGCTCGCCCGAACAGGTGCCACAGCAGACACAGTAGCGCAGCATCTTGGTAGTCACTAGAGCAGCTTGCATGAACATACAA
GTACGCCAGCATTCGTTTCAAGTCAGCCTTTGTACATGGTGGTGCCTTGCTAATGAAGCCACCGCCGTCACGTTTCATACAAAAATTGTCTAGAGTCTTC
CCCATTTTGAGCAACCGTGCTTCCAGTGCAGCTCGGTGCTGTGGAAACTGATCCAACAGCCAAAGTTTAGCTTGCCGATAGTACTGCATCGAAGTGTTCC
GTGATAGTGGCTTGCCTTTCTTACCCTCTATGAATGCAAGATGCATACCAAACTTGTCCATTACGGACACAAAGCACTTCCCACTCTCGTCACGCTCAAT
ACACACACGTACATACTCCTCTGTCACACCCTCAGACTTTAAAAATCTCATGAATGCTGACACGGCAGTTGCCTTGGCACGCTTCGTGTTTCCAGGGGCT
AGCTCCTCCAAACCCATCCTGCAGGTCGGATCGATGGCAAATATGCGAGTGCTATGCTTTTGACTTGCCTTTTGAGAGACGATACACATATTTGGCGACT
GTTTCCGACGGAACGGCTGGCCTACAGGACTTGCCTTATACGTGTCATGCTATTGGCCAAAATACGGGATCTAATATACAATGATTGGTTTAAATTGTAC
ACCTTGGCTCCCATTGGCCTTTATGCTCAATACAAACTCAAAGTACAGTCGGATAGATTGTCATATTCAACCATACGTTTGACACGCGAAGCTCGGATAC
TTTGCCGGATTTTAGTCCTGAAAGTGCACC