Description :
From Genome Similarity Track
Location :
Scaffold_329:1443- 2988
Transcript NameFunction/comments
Hyaar_Emoy2813775origin recognition complex subunit 4

Sequence
1545 bases(100 bases per row)
TCACAGTCTCTAGCACAGCTAGTTGGTGGTCCTGCTCCAGTAATTGTCGAGCACGCCAAAAATGCTGAGCCGATAGTAGCGGTGCATCAATATCCAGATA
TTGGACTGCAGCAGAAGTCAGCCTCACGAAAAACACTTGCGGCTTGCCAATGTCGTAGTCAAACTCGAGGCTCGCAAGGAACTTGCTTTGCTCTAGTAGC
AGCTCCTTGATTCCGCAAGAAAAAGCTGCAGCGTATTCGGTAGAAGGTTGTCGTAACTCGCTGTGAGCACTCCATGGAAAAGTGTCGAGAGAAAGCAAGT
GTACGAGGTGTTGACGTATCTGCGCAAACGAGAGTCTCTCCACGATAATTTGAAGATTCGAGAATCTGCAGTTCAGCCGGCAACAAATACGACAGCGAAG
ACGATTTGATCAGCATACAGAGCTTAGACGACTTGGAACTTACACGGAAGCGGAACATACATGCACGTTTACCTGGAACGCACTCGCTTTTCCAGATTGT
CCACGACATTGTAGTTATCGGTGATACCAAGCACGCCCATCTTGATGTCTCTCGCCTACGTTCAGTCAAACGACATGTTGACTATATGATACGCTCTAGC
ATGAATGATAAAACAACATCGTGACGTCGCACCTGCAGCCAGTCCAGCAAGTTATACAGCAGCAGCTGTTTTGTGTTACTCTTTTCTCGCACAAATTGGT
CTAAGGCGTCTAAAATGACAACCACGTGATCTCCAGCTTCGGCTTTCGAGACAAGCAAACTGCGTAGATACTCGTACATGTTCCAGTAGGACAGATTCTG
TTCTCCACCATTGCAGTTACACCCATTATAACATTAGTAGCTACTTCGAAGTTATTGTCATCATCACACGTCATTGTTTTGAGCCTACAGGATGTTTCAC
TGCTGTAGCTCGTGTAAGCTGAGCCGTGAACTCCTTGAAAGCCTCGAGCTCGTTCTGGAGAATCACTCCATTGAGGTACACGACAGTGAAATCCCCAAAT
TTGCCACGCAGGTTGCGCATTGCATGCGTCACAATGAAGCGTCGGCGACTACTGTCCGACCCGAGCAGCAGACCTGACTGGTTCTCGCCAACCTGCACTG
TGCGCTCGAATAGCTGCTCGAGCTGCGTTACCGCCTCCAAACTGCCTTGACCCGTTACCTCATTTCCATTGACAAAAGTGTGGGCAGAAGACACTTCGCT
CTTTAGTCGCATCCGCAGGGCGCTGCGAGCAGAGAGCACCTCTTCTTTCAGGTACATGGTCTTGTGATGACTTGGTTCGCCACTCACTGCTCTGCGTCCC
CTAGAGACTTCGTTAATTTGGACCAGATTGTAGATAATCGAAAGCACGAGTTGTTAATTTGTAGGAAGATTCGGGCCGAAACCCAAACTCAAAGCTGCGG
AAGACAGGGTCCATGGACCGATGACGATGTACCCGCTGTACGTTATTCACTTTGCTCGGACATCTCGATGATAAGTAGCAAGCTGCGCCATGGTGGGGTA
GCAAATTAAAGGAGGCTGCTTAGATATAGCGGCCCCTGCTCAATG