Description :
From Genome Similarity Track
Location :
Scaffold_381:1443- 2885
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_381-abinit-gene-0.23Protein kinase C inhibitor
Pytiw_DAOMBR242034maker-piw_contig_381-fgenesh-gene-0.5Metal dependent phosphohydrolase

Sequence
1442 bases(100 bases per row)
TGAACCTCATCATGTGAATCATTCCGGATCACTTTGGATATGCTCCGTGGAGCTCTTCGTCGTGGGGCTCTCTCTTCCCAGCAACCGCATCGCCCTCCAG
TCTCCCGCGCAGCGTCGCAGCTGCTCGCCCACCAGCGCTTCATGAGTTCCTCGTCCAGCGACGAACGCGCGCGCTCGGACGCTGCGGCCGCCGCCAGCGA
CAATGGCGCCGAGACGATCTTCGACAAGATCATCCAGCGCCAGATCCCGGCCAAGATCGTGTTTGAGGACGACCGCGTGCTCGCATTCCACGACGTGAGT
CCGCAAGCGCCCGTGCACATCCTCATCATCCCCAAGGCGAGGGACGGACTCACGCAGCTCGCGAACGCCGACGAGCGCCACGAGAGCATCCTCGGTCACC
TGCTCGTGACGGCCAAGGTAATCGCCAAGCAGCAGCAGCTCGACAACGGCTTCCGCATCGTGATCAACGACGGACAGGACGGCTGCCAGTCGGTCTTCCA
CCTGCACCTGCACCTGCTCGGCGGTCGCACGCTCGGCTGGCCGCCAGGCTAACGTACCTAATCACATCTCGTTTGCTAGTCAAAGGCGACTGACTCGTCA
CTAAGCGAAAGCCAATCAATGTTCTCATCAGCAAAGCTGCTATTCTCTGTATCTAAATTTCCTGCATCATAGCTAATGGCACTATTAATATGTCTAGCCG
CGCCCGCTGATCTCCTTGTAGAACTGGGCCACGAACACCTCCATGAACGCGTGGCGCTCCTCGGCGATGCGCTTACCGGCGGCGGTCTTCATCATGCCCT
TGAGCTTGAAGAGCTTCTCGTAGAAGTGGTTCATCGTCGGACTCGCGCGACCCTGCTGCATGTACTGCTCCTTGCTGAGCTCCTCGGTGGGCGGCATCTC
CGGGTCGTACAGCGCGCGCTTCTTGTGGCCGCCGTACGTGAAGCAGCGCGCGATGCCGATGGCGCCAATGGCGTCCAGGCGGTCCGCGTCCTGCACGCAG
CCAAACTCGACTGAGAGCTCACGTGGCGCGCCGCCAAGCTCCTCCTTGAAGCCCATGGTGTCGATGATGGCCATCACGCGCGCGATCTTGTCGCTCGCGA
CGCTCTGCGACTCGAGGAACTGCACCGCACGCTTCGTCGGCACGTCCTCGGTCTGGTACTTCCAGTCGTCAATGTCGTGCAGCAGCGCGGCCAGGTCGAC
GATCTCGAGGCTGTCCGCCGGTACGTTCTAATACAATGCAGGTAAGAATACACTGGTCAGCCAAATGATCATTACAGGTGCTTGATAGGTGGAGCAGGAG
CTAATGCACCTCTTCCTGCGCCAGCGTGCGCGCGAGCGTCCACACGCGCTCGATGTGGCGCCAGTCGTGCGACGCGTCGTTCGACTGGAGCTGCTCGTGC
ACAAAGTCGGCGGTCTGCTGCACGAGCGGCGAGTTGGCGACC