Description :
From Genome Similarity Track
Location :
contig_86:144299- 148830
Transcript NameFunction/comments
g12379.t1hypothetical protein

Sequence
4531 bases(100 bases per row)
GGAGTTGGGTTAGTAAAGCAAAGAGTTCTCCAGTGCAGAGGGTGAGTCCGTACATCGTGAGGCTACGCTGAAAAAAAGTCTTCAATCGAGCGTCTTAGTG
CATGCTTCCACAGACACCGACATCCAATTTGTTGGTATAAAGTCCAGGACCTGGTACGACGACAACGAAGCATTGCCTCGCTGTATCCAAGAGAATGGGC
CGGAATTTTTTTTTGTGCTTCTAGAAGAAGAGTTTGTGTAAGTGTTGAATTCGTTGGTTCACTACAGTGAGGTGTACAACAACTAAGAGAAAGTAAATGG
TCCATTACATTGTTCAGATACGAGCGATTGACTTTGCTGTTTTTACTGCTGAAGTCCCCAGACATAGTTCGCGAACGACATGTGGCCGATTGCCCAGCCA
CCGAAGAGCCCCTTAGCTCCAGGTTCTTTTTCGTCCATGCCCGCTCCAGCAGCGACAACAAACGGCATGAAGTGGTCGGGCGTTGGGTGAGCGAACCTCA
CTCCAGGAGCATCCCGCCAGTTCGTGATCTGCTTCGTGCGCTCAGAGAGAATCAGCTTGGACTCGGAGGCCATCGTGCTGTCCAAGCTTTGAAAAGTTCT
CGCTTCCCTCCACGAGAGCAGAGCTAGAGCTACGGAGACCGCGGAGGTTATGCGTCGACTGCCCCGAGCAAATGATCAGCGTGTCTTCGTCACGAAAAGG
TGCCAGCGCCTGGCCCAGGCCGAAGTGAGTCTGGTTATCCAAGTACGAGTTGATGGACATGGTGACGATCGGGATGTCAGCCTGGGGGCGGATAAACCTC
AAAGGCACGAAGACTCCGTGGTCGAAACCTCGGTTCACGAGTTTGGCCTTGATGTCGTTCTTCTCGAGCTGATCCTTGACCTTCTGGGCGAAAGCAGGGT
CCCCCTTGGCGGGGTAGACCACCTCGTAGGCCTCGTCGGGGAACCCGTAGTAGTCGTAGATCATGTCGGGTTTGGTGGCGTTGGAGATCTCGAAGCCGCT
ACTGTCCGACTCGAAGTGCGCCGACACGAACAGGATTCGCTTGGGCAGGTTCTCGCCCTTGGGGTACAGCTTCTCGAACAGACCCGAGAGCAGCTCTACC
GCCGCCGCAGAGTCTCGCTTCACATTGTTGAAGTCGGAGGAGAGCAACCACAGCGGACCAGGTCCGTGCGAAACGGCGACTGTGGGGTGGCGGAAGGGGG
GCATCGTGGAGACTGGGCGGACTTATTGGGGTGGAAGCAAATTGCTCAATGAGACTGCATGGAGGGCATCAACTCAGCATGTGAAGCGATAGCGAGACAA
ACCACCAGGATGGAGGAAGTTCTTGAGTAGTAGAGCTGCAGACTTTGACAAAATGAAAGAATATTTTTAAAAAAATCTGTTCTCAAAAGACTGCATTACA
GTTATAAAGTCTGACGAGTCAAATATCCTAAAAGATGGCGTAATCTGGCTTAAAAAAAAAATGGACACGTCAACCGCGAAAAGGGGAGGTTAGGTGTACA
AAAATGGCGGGAATTGGGTGAGGAGTAGCCAATGATCTGGCGTAATCGGTGATATTACATTTTACAGCTCGCAAAAGAAGGGAAATTCGAATTCTACACT
TTTCTGCTGGCACTGCCAGTCAACGAACTACCATGGGACCAAAATATATCCGACCTCCGACCTTTCCGACCATGTATAGAAAATAGTATGCAATACAAAA
GCTGAGCGACCCTGTAAAAATATTCGTAAAAAGGTAAATACGTGTTTTGAAATGGATGGCACTGAGCCCACGTGCCCTGCGCAAATCCGTCGACGCGTGT
CAGTGCCCGAGTGACCATCCTGGAGGATGAATTGAGGGAGGTGTGCCGAGCATCGGTGCACTGAAGAGGGTTGTCGCTGCCACGAAGAACTGTGGTTGGT
TAATGCTCCCTCGGGCACTCCAACGAGTATACCCTGCGCTGAGTTGTACTAACCCCACCTTAGTAGCTCAGTGGTAGAGCCCCCGAAAGGGATGGTCGTT
GGGTCCGATTCCCACCTAAGGTATTTCTAATGTTCGACAGCATATTGGCCGGTGCAAGGCAGCGAGTGCGAGCCTATGTGTGGAAGTATGTGTCGATGTG
TGACAGTACATGTGTTGCGTTGTGAAGCAGTGTGTGTGTGTGTGAACTAACGTGTATTATGCAATTTAAAGTGCTGGCATATTTACGCACGAATCTGTTC
CAATATGTTCTGCGTGTAACCAGGGGCAGGGTCCTGGATGGCAGGTGTCTGGAGAAGCTGTTCGTGGCGCCCAATATTTGTGTTGAGTGTTCCAGCACGA
TGGAGTATGCGTAGGTGCTTGAGGACGGCTCCGGATCCACGGGAGCTGATGTTGTGCTCACCAAGGAACGCGAGAACAGACTCCTCCGCGCGAGCTCCGA
GCGACAGTACCTGATCGCGATAGTTCGGTGCAGTTGGATCAAGCACAAAGCCGTCCTCCAAGAAAAGCTTCATGTACGCGACAAGTTGCTTGGCATCGGA
CTTCTGCTGCTTCGAGATCGGTGCCCGCCACATCCGTGGTTCATGAGCGTACCACGCGTACCATGTCGCGCGAAGGTGAGTCACTGCTGATCTGCGCTGT
TTCTTCTTGACGTTACTGATGTCGCTTGTGTCGGTGTCTGGCTTGTGTCGTTTGCGTGTAGCATGGCTAGGATTGTTGTTTAGCTTAGCCTCGAGGGCAT
CCATGCGAGCATCTTGCCGCTTGACGTGCTGGATAAAATGATTAATGACAGCCGCTTGGTGGTCGATGATCTTCTGTTCTGCGCTTGGCTCCATCAGCTG
CTTGGATACCACGATCTGCTGTTGCTGGTGTGTGCTTTGTGACTTGGTGTCTTCACAGGTTAGCTGTGGGCTTGCAAGATGCGAAGACCACGCCAGTAAC
TCAGAGAGCGAGCAGCCGGTGTCAGCTACACAGTCTTCAATGCGCTTGACAGCAGGTGCTTCAGCGTTCAAGTCTTTCAACAGCAGATAGTGCCGAAGCA
CACTCGAGGTAAGCACATCCAGAACTGCTTGATTCACGTTGTGTCGTGTGGTTTCGAGATGGTGACAGGTCGTGAACAGACGGCGCTGGAAGCTAGCGAC
CATCGCCCTAGTTTGTGTGTCGAACGTTGTCAAGTTTTGGAGCGACACCTTTGCCTCAGCGCTATGTCCACTGAGTATCTTGCTAACCTTGTGATATTCC
TTGCTGGTAGTTGAGCCCCTTGTTTGTTGTGCTCATATTCCAGGCACCTCTGTCGAAAATCCACCGCGCCGTGAGCTCCCCGCTCCCATTGGCATGCTGT
GCACCGCCGCGTCTGAAGGAATGAGACGTCAGCGCAACCTTGACTCCTGCGGCTGCAGCAATTCGGTTCAGCAACCGGTTCACGTGGGAGTAGATGGTGG
GCGTCGTCTCCGCCCCAGCAGTCGACGGTGCATCAAGACCTGTGGTGTCTGTAGGATGATTGAGGATCTCGAGCAGCGGGACATCTGGGGAAAGCGAGAT
CGCGGCTTGGCCAGGCAGCTCCGGCAGGTTGTCGATGACGTCGGGAGATGGAGCGGTCTGCATCATCAGGGCCAATGCTATCGCGAGCATTGGGCACGTC
GTGAAGTCCGTTCCGGGGAAAAGCGACAAGCCCTGCTCTTCGGATGTCTTCATGCGAATGAAGCGCACGAAGAGCACATTTCCAGCGTCGATGGAGACAT
TGGGCTTGCGGAGGAGCGCGAGATCTGAAGCTCGCCCGAACAGGTGCCACAGCAGACACAGTAGCGCAGCATCTTGGTAGTCACTAGAGCAGCTTGCATG
AACATACAAGTACGCCAGCATTCGTTTCAAGTCAGCCTTTGTACATGGTGGTGCCTTGCTAATGAAGCCACCGCCGTCACGTTTCATACAAAAATTGTCT
AGAGTCTTCCCCATTTTGAGCAACCGTGCTTCCAGTGCAGCTCGGTGCTGTGGAAACTGATCCAACAGCCAAAGTTTAGCTTGCCGATAGTACTGCATCG
AAGTGTTCCGTGATAGTGGCTTGCCTTTCTTACCCTCTATGAATGCAAGATGCATACCAAACTTGTCCATTACGGACACAAAGCACTTCCCACTCTCGTC
ACGCTCAATACACACACGTACATACTCCTCTGTCACACCCTCAGACTTTAAAAATCTCATGAATGCTGACACGGCAGTTGCCTTGGCACGCTTCGTGTTT
CCAGGGGCTAGCTCCTCCAAACCCATCCTGCAGGTCGGATCGATGGCAAATATGCGAGTGATATGCTTTTGACTTGCCTTTTGAGAGACGATACACATAT
TTGGCGACTGTTTCCGACGGAACGGCTGGCCTACAGGACTTGCCTTATACGTGTCATGCTATTGGCCAAAATACGGGATCTAATATACAATGATTGGTTT
AAATTGTACACCTTGGCTCCCATTGGCCTTTATGCTCAATACAAACTCAAAGTACAGTCGGATAGATTGTCATATTCAACCATACGTTTGACACGCGAAG
CTCGGATACTTTGCCGGATTTTAGTCCTGAA