Description :
From Genome Similarity Track
Location :
Scaffold_39:144291- 145574
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012018Similar to C20orf108: Transmembrane protein C20orf108 (Homo sapiens)
Pytul_DAOMBR144PYU1_G012017Similar to Rad1: Cell cycle checkpoint protein RAD1 (Mus musculus)

Sequence
1283 bases(100 bases per row)
CTCGAGTCAACGTCGCTCCATGTCGCTGCGAGTGACGATGAAAGCGTCCCAGAGCCGCAGTTGTCATGGCGAGAGCGCGCCAAGACGTTTGCGATCGAGT
ACGGACGCGTCGGCGTGTGTACGCACATCGTACTGTCGATTGCGTCTTTCTCCACAATCTACGTCGTGGTCTCCAGCGGCGTCGATGTGAGTGCGATGCT
CAACGCCGTCGGGTATTCCGTGGGCGCGAAAGACTCGACCACGAACTCTGCAGGCTCGTTTGTGATCGCGTACGCGATGTACAAGCTACTGTCGCCTGTG
CGGTGGCCACTCACGTTTGCTGTGACGCCCGTGGTCATGCGCGCACTGCGCAAGCGGGGGTACATGCTCCCTGCAGCAGCAGCGCAACCGTCGTCCCGTC
GACCGTCGCCTACACATAGTGGCCCAACCGACCACAAGAAATAAGTCTTCGTATGTATAAACAAAGAAAAAAACACCAATAAATAGTAAGCGCATGTCCA
TTTAAATAGGTGTGCGTTAGTTCTTGTAGCTGTCGGCGTCTACATGGACGTGTCTTCTGGACTGATGAGCGCGTCGACGAACGCCTTTTCACCTGTGCCG
CTCTCGATCATGTGCTGCACGGAGAGGAAGCCATCAGCATTCATGCGCAGGAACGTCTCGTTCGAGCTCGCGAGCGCCTTAAACGCCTGCTGCAGCACTG
CGACGTGGAATGTCGCCGCGCATTCACCACTGTCATCGTCTTCATCAGCGGCAGCACAGAAGAACTCGATAAATGCCTTGGACGTGGCGCCAAATTCGAT
CTCGCAGGAGCCCGTTTCCGACGTCGCGCTGAGACTTAGGCACTTGTGGGACTTGGTGCGTGCACGCGCATCGTCGCCAAACATCGCGATCGTCACGGAC
GCTGCGCTCGGTAAGTCATACAGCTCTGCGAACGCGTCGTGCAATGGCTCGGACTGGATGATGCAGCGTCCGACCACGGCTGAGTGTTCGAACGCGCTCT
CGAACTCCAGCTGGCCCATGTCGTTGCCGTCGTGCTCGAGCACCTGCATCGAGCATTCGCAGATGACGCCATTGTCTTCAACGACAAGCAGCAGATGCGC
TCTCTCTGGGTCGTAGCTCATGCGCAACGACGTTGTGGGCAGCGCGCTCGGGCCAAAGATCGACAGACACTCGATCAGCGTATTCAGATTCAACGCAAAG
CTCAGCTGCAGGATATCGTCGTCGTCTTCGTACTCATTCTCACCACCAGTGCCGTCGACAGCTACAAACTCGTAGGACTCGAA