Description :
From Genome Similarity Track
Location :
Scaffold_356:14425- 15815
Transcript NameFunction/comments
Phymu_g9027hypothetical protein PHYSODRAFT_330930
Phymu_g9028hypothetical protein

Sequence
1390 bases(100 bases per row)
AGCAGTGCGCAATGCACGAGGCGACGTTCGTGGCGATGGCACTGTTCAGCATCATTTGGACATGTGCGTGCAACTAGCACCCGGCCTACAGCGCTCAGCT
GACCTCGACAATCCATTTGCTGACGCTGAACTGATTCCGCGTGCCATGCAGTGCCAAGATGACCTGCAGCAAGCTGTCGCGATGTACAACGATGCACTCC
TCGCTGCCTCGGGTATTGCACCGACCCAACAGCAAGCACAGgtccagcagccagcacaaCAGCCTGAGCCGCACGTCCAAGTTCAGCAGATGCCAGTACG
CAACGTCGTTCCTGCCAGTGCGGCCTAAAGCGTACCCTCGTGATACGAACGGCAAGGCGTGCTTGAGTTGTTGCTCAAGAAATTCTTATATGAAGCGCGC
GTTGGATGCCAGCCACCTTGTAACTAGTGAATATACCGTTTTTGAAGATTTCATATGAAATGTATTGGGAAAAATACAGCAACATGCAAACATCCACCAG
CGCCATCCTGCTAACGCACTATCGTCCGCTAACTTCGTTTCCAAGCAAGCTACCAACGGCTTCCTGCCGCTTCTTTCCCTCCTCCCATGCGCGTTTTCGT
CGGTCATCGAGCGCGGGTAAAGCTTGCTCCACTTGCAAACATTGCGCCCCTGCGCTCATACCATAAACTGTCCATATGCGTCATATGAAGTTTAAACACC
GTAGCTGGGCTGGTACGAGTTCTGCTGGCCCGGCACGTACGGGGGTGGAGCCTGCACGCCGCCACCCTCCTGTGCAGACAACGCGTACGTCTCCGTGACG
GCAAGCAGAGAGTCGTTGTACAGACCCATAGTCGTCTCCAGATCCTCCTGGCACTGCATCGCGCGCGGGATCAGGTCCACATTCGCGAACGGATTGTCCA
GATTCGCCGATATCTGCAGACGCGGCAGAAGTTGCACGCACACCTTCAGGTGGTGCTGCACCTGCGGGTCACGGCGCAAGTCACCACGCGCGCTACGGAT
AGAGGCGTTAAGCAGAGCCACAGCCTGCTCGGTGTGGGacagctcttcctcgtccagcggTGTGGGCAACTCGGTCGGCAAGCGAGCTTGTTCGCGAGCA
GCCATTCCTTCAGCACCGCCAGCGTTCACGTTCAGCGCACGGCCAAATCCGcctggtgcagcaccagacTCGTCACCTCCGCCCGACACGAGCTGACGAC
GGTACTGCTCAACCTGGCGCGACACATTCAAGAAGCGGTCCAGCTCCGGTACGTTCAAGTTCTCGGGAAGACGTGcgcacagctccaacacctGCGCCAC
GTAACGCTCCAGACCTTGCTTACGCTCCTCCACGATCGCGCTCGAGTTGCCCGTCTTGCCCTTGAACACACCGCCGAGGACGTGCTTACG