Description :
From Genome Similarity Track
Location :
scaffold_10:1442120- 1444141
Transcript NameFunction/comments
Plaha_PHALS_11811haloacid dehalogenaselike hydrolase family protein

Sequence
2021 bases(100 bases per row)
CACGCAGGCACATCCTGTTCAAACGTGCTGACAAGAATGATCGGTAATGCTGTAAAGAGAAGATTGTACCCTTGAAGTCCCCACTCAAGAAAGAACTTTT
GACCAGAGTAGCCCGTGTAGATCATGTACCAAAATTGCGTCAGATTAAGAATAACATTTTTGTAGAATATGTAGAGAATCAACTTTCCCATGCGAACATA
ATTCCATCGTCCGTGTACTAACAGCAAGCGCGACAAGAAACGAAACTGGGCAATGGCATAATCCGACGAATTTGCCGCTTgcattccttcttgccctgaa
ATCCCAACACCCACATGAGCAGCTTGAATCATTGACACATCGTTCGCTCCATCACCAATCGCTAGTGTACGAATTTCGGGTTTATTGTCCCGTACCAGTC
GAACCAATTGTGCCTTCTGAGCTGGCGAAACACGACATGCTATTACAGCCACACACTTTTCTGCGACTTTCAGCAGTAGCTCTGGACACTCTTCTAATGC
CACTTCAAGCGTTTCACCATCAATCACCAAAGCTAATTCTTGCTCTGGCATTTCCGCAAGACTTTCAATGCGCGTGCGTCGTTTGCGCTGATCTCTAGTC
AAAACAGAAGTACGTGTGTCCAAGGCACTCACAGCAGGACTTCCATCACCCACTTCGTCATGCTCATCTCGTACATGTGCCTGTAATTCATCCATAATTT
TTGTCAAATCTGGATGTGTATCAGCAGAGATAACAATCCGTTCAATGTCCGTAGCTAATAATCGACATGCAAAGCCAATATTTATGGCCGTTTCCTCTTT
ATCTCCTGTAAGCATCCAAATTTTAATCGCAGCCTGTCGAAGCTTATAAATTGTATCTGGTACCTCCGCTTGTAGTCGATCTTCAATCGCAGTTGCTCCT
AGAATATCAAGATTCGTCTCAATCTCGTTCATTAATCGATCAATATCATTGTCCAATCCATTTCGACGTAAATCAATTTGACGCATGTCATTAATTGCTG
TACGATAGCGAAGAACCCACGCATCAAAAAACTCAGGGTCAATGTCAGTCATTCCAATCACAAGTGTACGCAGACCTTCGGACGCAAACTGTTCCATATG
TTGCAATGTCAAATCTCGTGTTTGATTCACAATTGGATCAGTTGTTGGACGCAGACGTTCGTACATGACCGTATCTGCACCCTTACAAAACAGTGTCAAC
TCACCACTTGGTCCTTTCACAATCACCGACATGCGCTTGCGCGTACTATTAAACTCGAGCACTTCTAATACTTCGTACTGTCCGACCGCATGTTCTAAAA
CAGGTTGATGACAAAACATTGCATCCGGATTGTCCACACACGAAAAATACTCAACCATGGCTTTCCCTGGTCCACGTGCTACAAATTTGTACCCAAAACA
TGCAGCAGCAGCCACTAGCGCTTGTTCATCAGGTGACGATGCACTCAAGCGCAAACTATTGTCGGCCGCTTTTTCTGGCATCACTGTATGGCACACAGCC
AAGTGTTCAAAGAAGGCACCAATAGCTTTGGCCTGTGCACTATTTTTCTGTGCCATAGCTTCAAAAAGTGCGTCATCTTGATAATTCACAAATGGCACTT
GGACCACTCGATCTGTGGGTACTAAAGTCGCATCAGGTACAATATCCCCATACTCTTTCTTGACACTAAATGGAGTAACAGAGATAACGGATGTTTCTGC
TTCTTGACGATTTCTTGCAGCAATACCAACTTCAGTCTCCCCATGACCATAAGCAATTCCATTGATTGAACATTTTCGAAATTCCATTATATTACACGTC
AATGTCCCTGTCTTATCAGAAAAGATATAGTCAATTTGACCCAATTCTTCATTCAAAGACATGGTACGAACTTGACAAGGGGTATCCGTTTCGTGATGAT
ACATTTCCAAGTCATTATTCATAAAGAGCGATTGCATAAACTTCACCGACGTCATACTCACGTAAAGAGATACAGGAATGAATGAATTTAAGAGTAAAAA
GTAATACAGGACCATAATGAA