Description :
From Genome Similarity Track
Location :
Scaffold_49:1442- 7986
Transcript NameFunction/comments
g6928.t1hypothetical protein
g6929.t1hypothetical protein
g6930.t1hypothetical protein

Sequence
6544 bases(100 bases per row)
TTCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCTATCAGGGCATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATTCGAAAATGAACCGGACCTCGGGTCTGGTTCCGATG
ACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCATCTCGCAACGGGGGTGGGGTGGGGGGCGGCGGGAAGACGCCCCGGGTTTGGTCAACC
AAACCTTGAGTCTCGCTTGAGGCTGTCGAGCGTCTCCAAGCGTCGGCAGTTCGCTGCTGCTGGCGTCAGGAGCTGAGCTTGTTTGAAAGGATGCAGCTCG
CGGAGGTTGCGCAGACGACTTCGAACGTAAAAGGTCGAGTTTTTTCCGCCCCCGCCCCCCCCGCCCCCCGACCCGCCCGCCCCGCCGCCCGCCGCGCGCT
CGCGCGCCCCGCCCCCCCCGCCCCCGCGCCGCCGGTGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGAAAAGAAAAAAAAAAAAA
AAGGTCCCCCCCCCGCCCGGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCTCTCTGGTGCCTTGAAGCGCGTC
GCCGTGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGCACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAACACAT
GCTGGATGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCACAATGAAGCGCGGAGCAAGCAAGCTTGCTCCAAAATCGGAA
ACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCACTGCCGGTGTTATCGGCATTCAGCTTCT
GTTGATTGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGACTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACTCCTGGTTCAG
TTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCATCGTAGACACTGTCTTGTCGTCGCCATGA
CTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATACGCTCCCCCACTTA
AGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGCGTGTCCAGTCGAGACATGCACCGGCGAACC
CCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCAGGGTGTCAACCATCGCGCGGTTGACACGCTCTGTTTGTCCGTCGGT
CTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACATG
GCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAA
GCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTTTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTC
GGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGTACGTTCGTGCTTGCGTACCCATTTGTATTGGTGAC
TCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCTAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAG
ATCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGA
AGGTGTTTGGCCAGTTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGCGCGTATGCGGCCTTCACGT
CATCCAACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGTGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTC
GGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCGTTGTGATATGCGCGGCGAC
TTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAACCTTTGCGAGTGCATACTTCATGGCAA
GGAGTTCCTTGTCATGTACCGGGTAATTGCTCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCAT
CAGTGCGCATCCGATCGCGAAATCGAATGCATCGCACACAACGTGAAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGC
TTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCGGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGC
TCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTCACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGG
GTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTTGGTCGCCCCGAAGATACACTTCTTCAGGTTTGCGTAGAGCTTGTGCTTT
CGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCTCGGCTGTGAATGAACACGTCGTCGAAATAGC
TCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGACATCACGAGCCACTCCCA
GAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCAAGAGTACTGAAGATA
ATACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCACCGGTACCGTCGCATCGTTCAGCTTATTGTACGCATGAACGATGC
GCCACCCGCCCTGTGGCTTCTTGACACAGAACATAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTC
GTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCAATGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCC
TGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTGCATCCTTGCACTCACGCAAGACCTTGTAAAAGGGGGTCGCTTTGAGCGAGTCCCAGCCTTGCTCGT
CGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCCCCCTCAGAGATAAGCTGATTCAGCTCTTCTGCTTCACACGTCATCATCTCGACGTCCGA
GAGGATGCAGATCTGCTCGATGCATCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGA
GGATTCTCCAGCCTCATCCTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGATTCAACGATTGGCTCCAACTCCTGCGTCTGCCCGG
CAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTC
TTCTTGTCCAGGCCCGGCCGTGGACAATTGTTCCTTGTATTCGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCATCGCT
TCGTAGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCAACG
CGCCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTACCTGTCGACACGACCGCGTCGCTTCGGACGCTTCGAGA
CCCTCGCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACATTTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCACTTGGGGTGATCGGAGGCA
GCCGCATACCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGTATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCACTGCTGCTGCTCC
CGAAGCACACGATCGTGCGCTTCGTCCAGTCGATCACCGTATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAG
GACGATAAGCTCGTCGACGAACTTCTTCTCTTGATATGAGAAGCGTACACGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAACCTCACT
TCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACGGTCCACTAGAGCAC
GAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGCAAGCGATC
TTCAGTTGCAGGGATGTCGCGAATGTCTGACACGCTCGCACCGCATCACCAAGGAGAGCGCGGGGCGCCCTGCTGTCCCACGTTTATTTTTTGTTAGCCC
GTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGAAGTTTCCGCAGCGGAAACAACGC
ACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCTCGACGGCCGTACCACCGGTCGTGGCA
TCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCACAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCG
GAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGGCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAG
TACTGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACG
CTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACA
TGACATGGCGAACGCGACGTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGACAGGGGCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCT
CTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCA
CGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCATTGGAG
GGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCACAACATGCGTTGCAGACGTGTTTGGGCTACCCACTGACATGTTACTGTCCGAGGGC
AGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCAC
TACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAA
AAGAACCAACGAAAGCTTTGGTGGTAAATGAGACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGA
TGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGATGTTACTTTCTACCAGTCACACGCTTTTTCTATGAATGTGGACCACCCTGTG
AAGTGTTCAACCTGAATGTATTCCTTAGTGCATGTTGCACTAAG