Description :
From Genome Similarity Track
Location :
Scaffold_596:14419- 16285
Sequence
1866 bases(100 bases per row)
CCTGCTTGCTGTGCTGGACGGCGGCCGTCGGCGAGTCGTAGATGCGCAGGAACACGCTGGTCGCTGATGCGGGGGACATGACGCCTTCGGCCTCGACATT
GTCCATCTCTTGAGCGCTGAGGTGGCCGGCGGTGTCCCAGCCGTCGCTCTGAGAGTACCCGCGGTAGGACAGCACGCGTTCCTCGTCATCCGAGTAGCGG
CTGCGCAGGAACGAGCGGCGCATCATACGCATGCGGATCTTGGCCTGCTCTTGGACGATACGCTTCTTGCTGCTGCCGATGTGGTTCCCGTGACGGTCCT
CGCCTTCCGTGTTGAGTTCGTCAAAGATTCCCGTGAGGCTCATGACGAGCACGAGACTCGGCATCGTCATGGGCGTCACGACGAACAGCGCGAGCGCCGG
GAGGGCCACCATGAGCGCCGCGTAGCCCCAGGTCATAGCGGTCGACGATGGCTCGTGGATGACGGTCGGCAGCTCGACGAGCGAAAGCCACACGAGGTAG
AACGCCTGGCCCGTGGTCGCAAACTGGAAGGCGCGCAGTAGCAGCGTTGGCCGACCGAACCAGAAGCGGTGGTCGTGGTGGTGGAGCGCTCGGTGACACA
GCGCCGCCATCTGCATGCGCAACAATGCTCGCACCGCGAGCGCTGTGGCCTTGAACGTCACTTTGCGCTTGGGGACCGACTGACTCTGGCTGGCGTTGAG
AGCTTGAGCCTTGGCGAGCTTCGTTTGAATATCGCGCATGGTGAAAACCCGCAGTCGGTCGTCGACGATTCCCTTGAGAATGTGGAGCACCTTAAGGAAT
ATGATGGCGTTGGCGAGCAACAGCAGCGCGCCGACAGCAGCGAAGATCTCGTGCGCGTACTTGGGGACGGCGGCCGGGAGCACGGCGATGGTCACGAGCA
CGATGAAGGCGCTCGGGTGCAGCGACGTCATGTGGAAGAGCAGGTTGCGCATGCACAGCACGTGGTACTGATCGAATGTGAACGGCGGGCGGGGATCGTC
CTCCTCCACGTCGTCGTCAAGGAGGTCCGATCTGAACGAGGCTTGAGGCCGCACGCCGAAGAGCCGGTGCATCTCGTTCGCGTTCTTGTAAATGTACCCG
GAGCGGTGCTGGCAAATGTTGTACGCGAGCAGCTCGAAGCTCTTGTAGAGCTGCCACTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCCAGCCCTCGCGCTCGTACCGATGCAGCAGCAGCGCGTACGCCTTGGAGCCGACCGCGAGGTCCATGCCCGACTTGGCGCGGTCCCGCGGAGCCGC
GAAGCTCTGCATGATGGGGTTGCGCGAGTCCTGCCGGCACCACGAGAACTGGTTGGCGGTTGTCGCGGGCGTGTCGTCGACCGTGTCTTCGTCCAGGTCA
TAGTAGTCGAGCCGGTCTTCGACGTCGCGGTACTGGCGGCGCTGGGACGTCTCCCACACGAGCTTGGGGGCCACGGTGCCGATGAAGAGCAGCAGCAGCA
CTATGGCGATGAAGTAGAGCATGGTGAGGAAGACGACGTAGTGGAAGAACTCGTAGAAGTGCAGTCGCTCGGTGGCCGTCATGCTCGGCGTGAACGAGAA
GCGCAGTCCGTCGAGCGCGCCGCTCGCGTTCAGCGCGAAGATGATGAGCGAGAGGAAGCCGAGCACCATGATCTCCTGGAAGAGCCTGCCGACGATCCGC
GCGAGCTGCGGACAGGCGATGGCGGCCCGCGACCAGTGCAGCAGCCGCTCGAAGCCCGTCGAGACGAGCACAATGACGCCCAGCAGGATGATCGCCGCGC
CGAGGTTGTCGTGGAGGCAGGCCGTGTTGCCGACGCCGAGAAAGGACCCGCTCGCATGACACACGC