Description :
From Genome Similarity Track
Location :
Scaffold_350:14418- 15589
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_350-fgenesh-gene-0.3RL38, ribosomal protein 38 60S large ribosomal subunit

Sequence
1171 bases(100 bases per row)
CGCCGCGAGTGCTGACCGCGGCCGTGCGTCGGCCGCCCGACCGCGAGCTGGTTCAGATGGAGCAAGCCGGCGACTGCGGCTGGTGGTTGCGGCCCTGGAC
GTTGCTACTGCTGCTGGCACCGGCCGGCAGCTGGAACTTCGCGGCGATGGGGCACACAGCTAAAAATTATGAGATGGAAAAAGACAGACGGACGGGCAAT
CCAGGCATAAAAGAAGGCCGCTAAACCGCGCAGCAGAGGGCGTGGAGAAGTTCCCACTGTTCCGCCTATCTTTCGCTGGACTGTCCGACAGTAAGGCAGC
GGGTAGGTGTGGACCGTAATTTTCTACCAATCACCCTTATTTGCTCTTTGTGCGAGTGCTTTGTGAAGATCGGGTTGTATTTTTACTCGAAGCGCGTATT
TACGTATAACGAGTGAGCGAGTACCGTGGTAAAAACCGCTGCTCTCGAATGGGGATTCTGGGCCAACCAAAGGCGAGTGATAGCGGGTTTGTATGCCGCG
CGGGCGATTTCAAGCCAAGCTTTGCATGGGCCGCCCTTAGTTACGTTTAGAAGACCAACGCAACATGGTGAGCGGAGCGTCTTCTTTTCGGCCGCGCGCT
GGCGGCGAGGGGGCGAAATGGCGGTGGCGTCGACCAGGGCACGCAGGACAGGCAGGGCATGCAGGGACACGCGGGCTCCAGCGACTGGCTGGCAGCATCG
CCGCAGCGGCGGTCNNNNNNNNNNNNNNNNNNNNNNNNGTGGACGAGCGCTAGAATGGTTGGAGCCCGTCCAGCCATTTGACAGGACAGCGACGACAGGA
CGTGCCCGTTGCCAGTCTGTGTGCCCTTTTCCAGACTGCGCCTCGCCTCGCCTCCTCGCTGCTTGCGCAGTGTGTTGATGATGGAGGAGCGGTTGATTGA
CGCTGGATGTGTTGTTCGTGTGGTGACTTGCAGCCGAAGCAGATCACCGACATCCGTGACTTCCTCCAGAAGGCGCGCCGAAAGGACGCCCGCTCGGTCA
AGATCAAGAAGACCGACAAGGTCGTCAAGTTCAAGATCCGCTGCTCCAAGTACCTGTACACGCTCTGCGTCACGGACACGGAGAAGGCCGACAAGCTCAC
GCAGTCGCTCCCGCCTGGTGCGTTTCGCTTGTCTGTTGCCGCCTCTGGCGGGCGAAGTTAATGGGGAGGAC