Description :
From Genome Similarity Track
Location :
Scaffold_885:14415- 15495
Sequence
1080 bases(100 bases per row)
GCATCATCCTTCGTGTATGCTTGCTGGTATTCCTCGATCATATCACCAGAATCTTCGCCGTTGATAAATGAATAATTTGTATGCGAGGCTGTGAGCGCTG
CAAGAACGAGATTAGTTTCTACGACTTTAATATCTGCTTCCGGTCTCCTAAGCTCCCACAGCAATGGCCCTTCTCCGTGCGCACGAAAGGCTTCACCTGC
AGCGTACGAATAGCTGGTATCGATAGCACGAATCACATGGGGCTTCAATTTGTGACCAATTACAATCGGGGTAATGCCGGCGCGCGTATCTCCTTTGCGC
TCTCGTATTATTTGCAACGGGCACGTTGGCCCTTCATGCCGACCGGCCGGTCTGGCTAGTCGGCACATATATTTCCCTCTGTTGCCTTTGAAACAAGTAT
TTGTGTGAGAATAAAAGTTTGTAGTTGCAGCTCGCATCTGCGCAGCCTTGAGAAAAGCTGCAAAGTCAGCCTCAGGGTCTGGTAACGCAATTTCGAATGA
CTTTGGCATTGCTCTGTCTTCAGCAACGCAATCGTCGCGCCACGCATGCACGGTAGCGTCCAATTTGGTACAACATATCGACTCTAAccaccgagcagca
cgtttACAGAGCACAGAAGAGCTCTATTCTTGATAGCAGCACTGGGTTAAACTTCGAACCATACAGTGTCATGTATATGTCAAGCCTTCCATCAACTTGA
GGCTCCACAACAGCGGCAAACGCTGCTATGACCCCATACGCACCTGCTTCTCTTTGAGTGTAATCCCGCGAAATTCGCGTGTCACTAGCTGCTGTGCATA
TCACGATGTCACTCAAAATCTGTTTTGTGCACCTGTCAAACACGCGCGCGGCTAAGGCAGGATAAGTGTTGGAGACGGCAAGCCTACCACGATTACCACA
ACGCACCGAAGCTGGCAAATTATCTTGACAGCACTGTTTCCGCTGAAAAATAACACCAGGTTGGTTCCAGGCGTTCATTTGTCGAAGGGCTGCAATGCGA
TGTAACTCAAGGTTGTGGTGTTCCGGCGGTGCTACCGTGACCCAATGCTGTGGGATTCCATACCGTGCTCTCAAAGTACC