Description :
From Genome Similarity Track
Location :
contig_5:144133- 150267
Transcript NameFunction/comments
g1517.t1hypothetical protein

Sequence
6134 bases(100 bases per row)
TGCGAAGTCTTCCGTTCCGACTGCTAGCCGTGAATGATGTGGATGTGCGAGATGCCGGTCGACACAACTGGCACCAGCCCGGTGTCGTCGAGGACTCGGA
GCACGAGCCGCTGTGGAGATCTCCGCCGTAAGCACTGCGAAGCCCCGCCCGCTCGTCATAAGGTCTCTCTCCTAACCTCGTATTCCATGTGCAGCAACAG
CTCGTACCCGCAGGAGCTAGGGCTGATTCTACTGTCAGTGGAGCCTGTGACGATCAAGAGTGTGCGGGTGAAAGTGGAGCTTACGCGAACGCCAGCTAGA
CGTGAGTGTTAATTCGGACTCAAGCGAAACAACCTTTCTCGAGTAATAATTGCTGCTTGTTTGGCCAGTTGAAATTTCGGTTGGACGACAGAAAGATGTG
GTTGCTTCTGGCCATCTCGATGCAGTGTCTCGCTATTTCAGTGCGGACTGGACACCAAGCTGGTAGGAACATTTTACTGTGTCGGTGCGGCTCACGAATA
CTGATGGTCTGATAAAATTGTCCTATAGCGAGGTCCTGATGTGGGAGGCGCGGATGGACATACCACAAGCAATAAATCCCAAGGCTGTTCGTCTTGATGT
GTCAGACTGTTCGTTCATTAGACTCGTTGTGCACGCGCCACACGAAAGCGCTTGTAATCGATCTCACGAGGTGCTGCTGCATTTTTGAACTGCTGTTGGC
ATTTAGTTTTCTATACGTGGCTGACTTTTCTGCCTTCATGCAGGTCGTACTGGAAGATATAGAGCTGTTAGGGCTAACTGGAGGTACATCTTGTCGGGCT
CGAAAGCTGGACCCAAATTTGAGGATAGTCGACAGGCAGGATGGTCCGTTCGACCACTGTTTTGGTCGCATTCGCCGCCCCTTATTACTTTCTCCGGACA
ACGATAGTGACGAGTTGCAAGCTGTTTTTTTGGATGCCGGCGTACCGATGAGTATCGTAGCCCAGGTTGCCACGATCCCAATCGTTGAAGCTGTAGTATC
GGCTTCAGCGCATAAAGGCATCAAGCCACTTGCTGGAGCTAGTGAAGTCGTTCCTAAATCAATCCCTCAAGATAACGAACTCACCGGCGTCCCAAAGAGT
GACAGTGGCACCATTGCGCCGCTAATAGGTCGCGATAGCAGCGACCAAGACAGGGGGCCAACGTCACCTTTCGACCGAGCGCTCCGACAATATATCGAGC
AAACAGCTCGTGAGAAAGCTATACTCGAGAAAATCCTTGCCACTGAAATCTGCGTGACCACAGACGACGTTGCGAGTTGGCAATCTCCCACGATATCACC
CACTGACCCCACTAACAGCAACGAGATCACGCTATACACGTTTGGAGAATTTTTTACACAATGTCTGCTCTGTGGTGGATCCGATATCCAAGTAATGTGT
GTACAGATGGCTGAGCGCTTTGCTCGACTTCTCAAAGACGTCGTTGGTGCAACATCTGCGCTCGAGGGTATCGTTGCACTTATCATTATAGGTGTTCGGG
GGGCAAAGTCTTCTCGTGTGTTCCGCGCAACGATTCATCTAGCACACACTGTGTTTCTGACTAAAATGGCAAATACGAAGAAGACAACATCACAATATCA
ACCTGGGGGTGGCAATACCCAGAATACAAATGACCCTGCAGCATCTGTCAGTACGTCGTCGCTAGGGCTAATAGAGGAAGTTGGTATCACCAACGTGAGC
TATGGGTTGCGAATCATTCTCGAGTCAACACTTGCGAGCCAACTTTGTTGGTCCTCCATTAACCACGCTAGCAAGCCAACATTTCGTTCGAGTACCAACC
CACACAGCCGGAAAGTTTCGGATGGGCTTCCTAAATTGCCTCCGTCAATCGACAGGGAGTTTCTGTATTTTATCCGGTCGCTGATCGAGCAAGATCTAAC
ACGTGCAAGCTTTTTCGAAGAGCTTCTTGGTCTTACTCCTACCGACAGTGCTGCCGGGGTCATTTTCACGACAAGCCGATTGCGATTGCTTCGGTTGATC
TTGCGGGATGACATGATTCACTGTCGAATTTCAACCAACGTGAAGGCCAGTATACACTCGCTTTGCTCCAACTGGTTGATGCCGAAAAGGTCTTCATCCC
GTGCTCTGGAAAATGCAAACCTTGATGACAAAGATGCAGTAGTAATACGACTTGCTTCGGAATGCTTAAATGAAATAGACCGATCGTCTTCAATTTCTCA
ACAAGCCAAGGATAACGCCAACCTTGTCAAGGGTCTATTGGTCGCTGTGCCCAAACACCTGCAAGTCGCAAGTATTCTAAACAGACATCGCTCCAACTGC
CACTATCACACTGCTGACTTTGTTCAAGACCCGCTTACGGAATTGGAGATTGCTGAGTTTGCCAAACAAATGCAGCGATACTTTTCATCCCAGCCTCGTC
CGAGCGCCCTGTATCGGCACGTATTTGTACGTGCACCTCAAATTATTATAGAGAAGGATGAAATGGAGCAATGCGAACTGTTTCAAAAAGGCAACATCAC
TTTCCAAGGGCAAGTTGTTGCCCGAACACCACCGAAAGAAACTTTTCACGAGGAGATTCAACGAAATGCAGCTTCATTTGTGTTCGACGTTGGTACTCCA
AGCAGCACGAAGGTGGCTGGTACAGCACCGCCACACCACCAAGAAGTGGTCTCGAGTTTTGCAGCTTTTCGAGGAACAATCGAACAGCGTAGCGATCCCC
CCAAACGGACGCGCAAAGTTTCCCCCGAAGATCACTTACAACCTCCCAAGACCACCAAAACTCTAGCGGTGACAAGTAATCAACCTGGCAAGAATGCTGT
CAGTAGAGCAACCATGATTGTGTCAAGTGATGCAACTTCTGCTGCTGCTGCTAAAAGCTCAGTTCAGGTCGTAGAAGACTCAACCAATATTGCAGATAAC
ACACTTTTACAGGAAGTACCTGCTGTAGCTCCAACCACAAGCACCGATTCAGTTTTGCTACCTGTCGCTGTTACACAAGACCCCACCAAGCAAAAAGCAA
ATCCCTATCAGCCTGAACGGGCCAAAGTCAAAGGCAAGGAGAAACGCAAAGGCAAAAGCGGTGCTAAAGATCAAGACAACTGCGTACTTCAGTAACAGGC
TATCAGCAGCAAGCTAATAACCAGTGCTCTTTCGTGATCGATAGCTTTGTACGCTCTGATTCAAGGAAAGTTCATATCGCTCCTGGAGCTCCGTTGATAG
CTTCTTGACGTAATGTTTCATTATGAATTCTTCGTCAACGTCACAGCAGAGGGCAAGTACTACCTGCTTAGCAGCTTCGCGGATAAGGGAGATTTCGTGT
TGAGCAGCGCCGCTAAGCAGCAAAAAGCGAAGGATACGTCGGGGCGCGATATCAAAACTTGCACAACAGTGAAACGACAATAGTAGCGCTGCTAAAAGCT
TCAAGATCGCTAGAAGCTGCTGGTCTGAGTGTTGGAAGTTTCTCCTCTCGGCATCTTTTAGAGTGAGGTGCGTCACGAATGTCCCTCTTGTTCGTGTTGT
CCCAGCGACCTATACACGTGTTTCCAAACTAGCGTAAATTCACTGCGTGGAGGCGTAAAGATTTTATGGCGTACCTACCTTCAAAATAGTGAACGCAGCA
ACATTGCGAATTGGCGCCTCGCGTGCGCCAAGCCTGTCTGTAAGTCGGGCAACAATTTCGGTAACCTATATCACATATCGAGCATTTCATGAGTTGTTGT
TAGCTCCAGATACTGTAGTCCGAAACTAAAGTACTACTGACTTACATCCAATTTTGAAGCGGCTGCATCTTGGAAGTATGGTAAACAAGTTAATAGTGCC
CGTAAAAACCCGCAGCCGGCGGCAAATACTTCGGCGTTTGTGTCATCCAGAACTACAGCCAATATCTCTAACGCTTCTGCACCCGTTATCGCAATTTGGC
AACTTTGATCTGTTACCTGCGAGCACTCTGCAAGCTGCCATAGTAATGCTTCTCTCTCTTGCCACTGACTTATCTTGAGCCTCTTCAGTATGTCATGTGC
TTTAAGCCCCTGAAGTGCTGTCAGCGCATGTTCATCTTTATCGCGCGGTCTCGGCGAAGAGGACATTTTCTGGGATAGCATCTTCTCTAGGTGATATCTG
CGTTGCTCAAACTCAGCAAACATATCGAGATCATTTACATGTTTGGTATCTTCGAGCTCTTTTGTACTTTGCCCAAGTAGATTGATCAAGTGGCTAGCTT
CCTGCTCCAAGGAAATCCACGGCTGTATTTGCTTCTCATTGCCAGCATATTGAACGAGTTGCTTGCCGATCTGAATGTCTGCGAAAATTTGCTCTGGTGT
CTTCATTTTCTGGGTGTCTTGAATCCAGATATCTGCTGCCCGAGGGGATCTCATTTCCCGTTCTTGCGCTGGGCTGGGGGTGGTCGTGTCGTAAAGACTA
TGGACACGACGACGAGGTGACTTTTTTGATGCACTCTTGAGAGGAGGTGGTATCAGTGGCAGCGCCACCTTCGCAATTTTCTGCGGTTCGAAAGCTGCTA
CTGATGCCAATCCAACTTGGCTAAAGAGATTGGTTCTTGTCTGATGGCACGGATGCAAAACCAGACGCAACAGTGTAATCTTCGAAGGTTGGGGAAGCTG
CACCTCCTGAAGTTCGCAAGCAGCACGCTGCGCCTTTTCATTGCTGCGAAAGCACACAAACCCAAGCCTCTCGAATCTGACACCGGTCCTACCGTCGTGA
ATTCCATTGCTTGTGGCTGCGGACGTGAAAATCTCAACTCGGGTCGCCACTTTGAACGGGTGCGATAGCAGATTCACCTGCTCAATGCATGTCGGTAAGC
CTCGATTGACGCGAAATACCAACTCTTGCGGGAACTCGCAGAATTTCTCCGATTCCCACACCGCCAACTGGGACGACGGCAAGGTCGATGCGCATTGGGA
CAGCGTCAGGTTGGCTGCGGGAAAGCGCACATCCTCGCTGGAGCAGTACAGGAGTTCCAGCAGAGAAGAAGCCCGCTCGCCGTCACTCATTACTTCAATC
AACCAAATGCCAACATGAACTCGGCACAAATGACTGTATTTTGGCACGTATAAATAACTTCAACGGCAACAAAAGGACGCTCACTCGTTTTCCAGAATGA
TGGTTCTTTATGTGTACATACACCAGTCTTTTTTGTTCCAGAAGGACCAAATCGGCACAATTGAAAGCGTCCGCGAATCTCAAGATTTAACCTCAAGTAG
TGGAGAGTGATGCCGACGTTGAGCGACGAGGAGCAGGAGCTGATCCAGAAGGACCGCGAGGCCAACCCTGGCTGCTTCTACTCGACGGCTCTGTCGCAAA
GCTGTAGGTCCATCAACGGCGACAGCAAGTGCGAGATCATCAAGAAAATCTTCCGCCAATGCCCCAACTCGCGCAAAGAGCTCATCTCGAACCGCAAGGA
GATCACCGAGGACGAGCACAGCGGAGAAGCGTCCACCGGCGACTTTTTCAATCGGGAGAGGATGGATCCACGTAAAGGGTACGCGCCGATTGGGACGGAG
CTTTTAGAAACTGAGTGCTGACCGTGGGTTTGATGTATTGTGTTAAGCAGAGGGGACAAGGACTTCTTTTTCCAGCAACGGTATGTTCATTTGGTCTTTT
GGAAGGGGTTTTGGTGTCTGAATCTTTGTTGCTATTTGCTATCAGAGGTGATGACTTTGAGGCCCAAATGAGTCCATTTGACTTCCTTCGACAAGAAATG
CTTCGTCCATTTGAAGGTACGAGCTGTCTGCTGTTAAGTGAGGAGTTTAGTGGTGGTCTAATGATTTGCTGTGCTATTCGTGCTCCTGCTGCAGATTTCT
TCGGTGGTGGCATGATGGGCCGTGGTGATTTCAATCCTTTTGAAGGTCTAGAGGGAGAGTTTGAGCGGATGCCGGTGCGTCCACCGTCGCCCACACCCAA
TCGCCCTTCACGACGACAGGCTCCTTCCAACCCTCCACACTACTCCTTCCAGCCCTCACAGGGAAAAGGCCCTCATGGTACGCTATTACATGTAGCTGTT
TTAACATTTGTAGTGGGTTACTGTCTCTAATGCTAATTTTGCGATCTTCCTGCAGAGGCCGGCGCAAAAGCGCGCGCACAAGGCAAGAGCGATATGTTCG
CTGACTACTCGGGTCGTGTGGATGAAATTTAATG