Description :
From Genome Similarity Track
Location :
contig_86:144126- 148607
Transcript NameFunction/comments
g10490.t1hypothetical protein PHYSODRAFT_254957

Sequence
4481 bases(100 bases per row)
GAGTCCGTACATCGTGAGGCTACGCTGAAAAAAGTCTTCAATCGAGCGTCTTAGTGCATGCTTCCACAGACACCGACATCCAATTTGTTGGTATAAAGTC
CAGGACCTGGTACGACGACAACGAAGCATTGCCTCGCTGTATCCAAGAGAATGGGCCGGAATTTTTTTTTGTGCTTCTAGAAGAAGAGTTTGTGTAAGTG
TTGAATTCGTTGGTTCACTACAGTGAGGTGTACAACAACTAAGAGAAAGTAAATGGTCCATTACATTGTTCAGATACGAGCGATTGACTTTGCTGTTTTT
ACTGCTGAAGTCCCCAGACATAGTTCGCGAACGACATGTGGCCGATTGCCCAGCCACCGAAGAGCCCCTTAGCTCCAGGTTCTTTTTCGTCCATGCCCGC
TCCAGCAGCGACAACAAACGGCATGAAGTGGTCGGGCGTTGGGTGACGAACCTCACTCCAGGAGCATCCCGCCAGTTCGTGATCTGCTTCGTGCGCTCAG
AGAGAATCAGCTTGGACTCGGAGGCCATCGTGCTGTCCAAGCTTTGAAAAGTTCTCGCTTCCCTCCACGAGAGCAGAGCTAGAGCTACGGAGACCGCGGA
GGTTATGCGTCGACTGCCCCGAGCAAATGATCAGCGTGTCTTCGTCACGAAAAGGTGCCAGCGCCTGGCCCAGGCCGAAGTGAGTCTGGTTATCCAAGTA
CGAGTTGATGGACATGGTGACGATCGGGATGTCAGCCTGGGGGCGGATAAACCTCAAAGGCACGAAGACTCCGTGGTCGAAACCTCGGTTCACGAGTTTG
GCCTTGATGTCGTTCTTCTCGAGCTGATCCTTGACCTTCTGGGCGAAAGCAGGGTCCCCCTTGGCGGGGTAGACCACCTCGTAGGCCTCGTCGGGGAACC
CGTAGTAGTCGTAGATCATGTCGGGTTTGGTGGCGTTGGAGATCTCGAAGCCGCTACTGTCCGACTCGAAGTGCGCCGACACGAACAGGATTCGCTTGGG
CAGGTTCTCGCCCTTGGGGTACAGCTTCTCGAACAGACCCGAGAGCAGCTCTACCGCCGCCGCAGAGTCTCGCTTCACATTGTTGAAGTCGGAGGAGAGC
AACCACAGCGGACCAGGTCCGTGCGAAACGGCGACTGTGGGGTGGCGGAAGGGGGCATCGTGGAGACTGGGCGGACTTATTGGGTGGAAGCAAATTGCTC
AATGAGACTGCATGGAGGGCATCAACTCAGCATGTGAAGCGATAGCGAGACAAACCACCAGGATGGAGGAAGTTCTTGAGTAGTAGAGCTGCAGACTTTG
ACGAAATGAAAGAATATTTTTAAAAAAATCTGTTCTCAAAAGACTGCATTACAGTTATAAAGTCTGACGAGTCAAATATCCTAAAAGATGGCGTAATCTG
GCTTAAAAAAAAAATGGACACGTCAACCGCGAAAAGGGGAGGTTAGGTGTACAAAAATGGCGGGAATTGGGTGAGGAGTAGCCAATGATCTGGCGTAATC
GGTGATATTACATTTTACAGCTCGCAAAAGAAGGGAAATTCGAATTCTACACTTTTCTGCTGGCACTGCCAGTCAACGAACTACCATGGGACCAAAATAT
ATCCGACCTCCGACCTTTCCGACCATGTATAGAAAATAGTATGCAATACAAAAGTTGAGTGACCCTGTAAAAATATTCGTAAAAAGGTAAATACGTGTTT
TGAAATGATGGCACTGAGCCCACGTGCCCTGCGCAAATCCGTCGACGCGTGTCAGTGCCCGAGTGACCATCCTGGAGGATGAATTGAGGGAGGTGTGCCG
AGCATCGGTGCACTGAAGAGGGTTGTCGCTGCCACGAAGAACTGTGGTTGGTTAATGCTCCCTCGGGCACTCCAACGAGTATACCCTGCGCTGAGTTGTA
CTAACCCCACCTTAGTAGCTCAGTGGTAGAGCCCCCGAAAGGGATGGTCGTTGGGTCCGATTCCCACCTAAGGTATTTCTAATGTTCGACAGCATATTGG
CCGGTGCAAGGCAGCGAGTGCGAGCCTATGTGTGGAAGTATGTGTCGATGTGTGACAGTACATGTGTTGCGTTGTGAAGCAGTGTGTGTGTGTGTGAACT
AACGTGTATTATGCAATTTAAAGTGCTGGCATATTTACGCACGAATCTGTTCCAATATGTTCTGCGTGTAACCAGGGGCAGGGTCTTGGATGGCAGGTGT
CTGGAGAAGCTGTTCGTGGCGCCCAATATTTGTGTTGAGTGTTCCAGCACGATGGAGTATGCGTAGGTGCTTGAGGACGGCTCCGGATCCACGGGAGCTG
ATGTTGTGCTCACCAAGGAACGCGAGAACAGACTCCTCCGCGCGAGCTCCGAGCGACAGTACCTGATCGCGATAGTTCGGTGCAGTTGGATCAAGCACAA
AGCCGTCCTCCAAGAAAAGCTTCATGTACGCGACAAGTTGCTTGGCATCGGACTTCTGCTGCTTCGAGATCGGTGCCCGCCACATCCGTGGTTCATGAGC
GTACCACGCGTACCAGGTCGCGCGAAGGTGAGTCACTGCTGATCTGCGCTGTTTCTTCTTGACGTTACTGATGTCGCTTGTGTCGGTGTCTGGCTTGTGT
CGTTTGCGTGTAGCATGGCTAGGATTGTTGTTTAGCTTAGCCTCGAGGGCATCCATGCGAGCATCTTGCCGCTTGACGTGCTGGATAAAATGATTAATGA
CAGCCGCTTGGTGGTCGATGATCTTCTGTTCTGCGCTTGGCTCCATCAGCTGCTTGGATACCACGATCTGCTGTTGCTGGTGTGTGCTTTGTGACTTGGT
GTCTTCACAGGTTAGCTGTGGCTTGCAAGATGCGACGACCACGCCAGTAACTCAGAGAGCGAGCAGCCGGTGTCAGCTACACAGCCTTCAATGCGCTTGA
CAGCAGGTGCTTCAGCGTTCAAGTCTTTCAACAGCAGATAGTGCCGAAGCACACTCGAGGTAAGCACATCCAGAACTGCTTGATTCACGTTGTGTCGTGT
GGTTTCGAGATGGTGACAGGTCGTGAACAGACGGCGCTGGAAGCTAGCGACCATCGCCCTAGTTTGTGTGTCGAACGTTGTCAAGTTTTGGAGCGACACC
TTTGCCTCAGCGCTATGTCCACTGAGTATCTTGCTAACCTTGTGATATTCCTTGCTGGTAGTTGAGCCCCTTGTTTGTTGTGCTCATATTCCAGGCACCT
CTGTCGAAAATCCACCGCGCCGTGAGCTCCCCGCTCCCATTGGCATGCTGTGCACCGCCGCGTCTGAAGGAATGAGACGTCAGCGCAACCTTGACTCCTG
CGGCTGCAGCAATTCGGTTCAGCAACCGGTTCACGTGGGAGTAGATGGTGGGCGTCGTCTCCGCCCCAGCAGTCGACGGTGCATCAAGACCTGTGGTGTC
TGTAGGATGATTGAGGATCTCGAGCAGCGGGACATCTGGGGAAAGCGAGATCGCGGCTTGGCCAGGCAGCTCCGGCAGGTTGTCGATGACGTCGGGAGAT
GGAGCGGTCTGCATCATCAGGGCCAATGCTATCGCGAGCATTGGGCACGTCGTGAAGTCCGTTCCGGGGAAAGCGACAAGCCCTGCTCTTCGGATGTCTT
CATGCGAATGAAGCGCACGAAGAGCACATTTCCAGCGTCGATGGAGACATTGGGCTTGCGGAGGAGCGCGAGATCTGAAGCTCGCCCGAACAGGTGCCAC
AGCAGACACAGTAGCGCAGCATCTTGGTAGTCACTAGAGCAGCTTGCATGAACATACAAGTACGCCAGCATTCGTTTCAAGTCAGCCTTTGTACATGGTG
GTGCCTTGCTAATGAAGCCACCGCCGTCACGTTTCATACAAAAATTGTCTAGAGTCTTCCCCATTTTGAGCAACCGTGCTTCCAGTGCAGCTCGGTGCTG
TGGAAACTGATCCAACAGCCAAAGTTTAGCTTGCCGATAGTACTGCATCGAAGTGTTCCGTGATAGTGGCTTGCCTTTCTTACCCTCTATGAATGCAAGA
TGCATACCAAACTTGTCCATTACGGACACAAAGCACTTCCCACTCTCGTCACGCTCAATACACACACGTACATACTCCTCTGTCACACCCTCAGACTTTA
AAAATCTCATGAATGCTGACACGGCAGTTGCCTTGGCACGCTTCGTGTTTCCAGGGCTAGCTCCTCCAAACCCATCCTGCAGGTCGGATCGATGGCAAAT
ATGCGAGTGATATGCTTTTGACTTGCCTTTTGAGAGACGATACACATATTTGGCGACTGTTTCCGACGGAACGGCTGGCCTACAGGACTTGCCTTATACG
TGTCATGCTATTGGCCAAAATACGGGATCTAATATACAATGATTGGTTTAAATTGTACACCTTGGCTCCCATTGGCCTTTATGCTCAATACAAACTCAAA
GTACAGTCGGATAGATTGTCATATTCAACCATACGTTTGACACGCGAAGCTCGGATACTTTGCCGGATTTTAGTCCTGAAA