Description :
From Genome Similarity Track
Location :
Scaffold_741:1441- 3946
Transcript NameFunction/comments
Phymu_g11791hypothetical protein PHYSODRAFT_320461

Sequence
2505 bases(100 bases per row)
CTGAATGTTCAACTTGAGTGTGGAGACATGCTTTCACACACGGGACCTGGCTTGCGGCGTACCTTGAAGAAAAACTCAGTCGCCTTGACTTGATATTGCG
GCCATGGCCACTGCCGTGTTAAACTGTATTTCGTGTCAGGTGTGATGTCGTTCTCGTGACAAACACTACGGTCAAAAGGGCGCTCCGATGGGATCTTGTC
CATCTGGCCGAATCACGTTCAGCCGCTTTGGTTGTCCAATCGAATTCTTCTGTAATCTATGCACCGATTCCGTCCGCGCGATCTATCGACAAAGAAAGAC
TTTGTGCTCCAGTGCCAAGCTGTAGCGCTTTGCAGGCAGCCATTGATCGTTAAAAGCAGAACGCTGACAGAACAGGTTGGAATGACTTGGTAAAAAGAGG
ACATGAGTGGGTGCCCCCCTGTTTGCCGAATACATCAGACTTGGCAATGAGTAAACTCGCACTACGTTACATTGGCCTGTTCAAGGGTTATCAAGCGCAT
CATATGTAACGCGGTTACAATCCAGTGGATAAAATCGCTTGGGAAGGAACCTTCAGCATTTGTGTGTGGGTCACACCAATAGATAGCAACATTGGTGGCC
CTCCAATGGTTCGCTCGCATGCATTAGGCACGCCTAAAATATACCGAAGCAGTGTTGTCAAGATGACACCTTGACAAGCTGGAACATACCGGTAAGATAC
CGGTGTGATTATCACTCAGTAGGACCGCGTTCATTCCTGTGTTGTCAAGAAGACACCTTAACGAAAACCTCTTTTTTTATCAACCGTGGATCAGGTCAAC
TTGTGGATCAACTTTTTAAGCGACGAATTAAGCTAATATGTTATGAAATAAATAATTCAACGGAAAAGTTGATCCTCAACTTGATCCATTATGCGACAAT
ATTCCTGTCATATCAAATGTTTGTGAAATATATACAATTATAAAGGTGAATGTATTAAATGTTAGTTTTAATTTTAGTACCAAAATGGCCCGCCGTTCGA
AGACTTGCCCCAAgtgcaagaagcgcttctcgacgcaTGGCAACATGAAGCGTCACCAAAAGAAGGTGTTCGCGTGCAGGGCGCAGGTTGTTAAGCAGCG
CAAGGACATTGCCAACCGCAAGAAGGCGCACCGCAACAAGTACGACTACCTGAAGCGCTGCGGCCGTCTCAATCAGTACCACGGTCCTCTCGCTCCATTC
GAtgagccaccaccagcaccgactGCCCCTCCTCGTCGACCGACGGGGCGCGCGACAACGAGCGTCGAATCGTCACGTGACGTACCTACAGTAGTGGGTC
CTGTCGTTGTCAACATTCATCATTACCATATGGATGAGCGTGACATCGGCGATTTCGTCGATTTTGTGTTGCAGGTTGGCAACTAAACGGTCCTTATGGG
TTCAGtgggtacactgtacctctTGTACCCATAAGGACCGGTTAAGCCGAACCGGTCCAATGCGACATCCACTGATTAGATGAGTAGGTTGATTGGATGC
AGTACCGCATGTCTTTGCACAGACTACGTAGTAAGACCAATAATGCAATCACTTCTGAATTTCTATTCAACCCCTCAAGTGACTTCCCTCGCCTCCGGTT
ACGTCACGATCTAACTGTGACCTTCTTCAATTTTTAAAAACATGAAATTGAAATACAATTTTGTTTACAATATGTTGGTTTTAGATTTATTACAACTATT
TATCTAAAAGATGTCCGTCAATGTGACGTCCGATGAAACCAAATGGATGCTGACTTAATCCAGATGAATGCTGAATTTATCCAAAATGCTTCTGAAACTG
ATCCATTTCGTGCTTAATCTCCAGTTCCTGTCTGACTAGAATAGCTTTAATGAAACTAAGCTATTTAATATGTATCAAATATGCAAAGCAGGTGTTGTTA
TTGTAAAACCTAAATGTGTAGTTAGCCCTGTCTTTCACCTGGATTTGGTAGTCAGGTGATGCCTCGACATCGGACTCGATATTAAAGGAGTCACTCCCCT
CTTCCTGTAACATGTTCTCTGCTGACACTGCAGTGGAACTCACGCAAGATCTGCGGCGTTACGGCTCACGATCTCTGCGGTTGGCAACATTCGTTTGTCG
GACACCACGAATTACTGAACGCAGAATTTCCGGTACTCTGATCGCGGTGAGCCAATCAAcggcgccatccagcgtCGCAATGCCAATTTCCCTGTCTGGT
ATTCCAAGCCTAATCATCTTTCGGCGGAGGgcctgcttgaagtggaaaagGCATCCAATAATCCTTGCCCGTGGAAATTGAACCTCCACCGAATGCATCA
TCGCCTGCTCGAAGTCACACGCGATATATGCTGGGTGCATCATAAAATCTGTGGAAGCGTTGATGTGGTGCAGCAAGTGATGGTACACTTTCTACGTTTT
CCCAGTCGTAAGAACTGGGATATAGTGGCCGGAAATAGAGTCATGCACCATGACAATGACGAGCTGGTAAAACGCGGTAGGCACGCATTTGTATGTGGCG
TCTAT