Description :
From Genome Similarity Track
Location :
Scaffold_599:1441- 2640
Sequence
1199 bases(100 bases per row)
GAAATAACGATTAATAATATCTAAGTTGGCGATCCAGATGTCCCAAGGACTGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTCTTTATTTGCTGATTATAACAGGAAATGATCTACCACCTGCTGCTCGTGGGGCAGTTTGTGGTATAGATGTGAGTGGGGCCAACCCATCGCGCAGAG
GGTCAGGCATGTGGCTCCCAAGTTTCGAGAGTAAGTCGCCGATCTGATTCAAGGATTACTGTCGNNNNNNNNNNGGCTATATATTGATTACGGAGGGTGA
ACCAGTTGACTAGGTTGATGGTATACCCCACGCCTATAATCAGTGAACTATTGCAGAACATGAATAAAGCTATGTGGTACTGTTCCCTNNNNNNNNNNTC
TAAAGCACCATGGGCATCTCCTATAATGGTGATCATCAAGAAAACAGAGAAGAAATAAGGCTGTGCATTGATTACAGGAGGGTGAATCCCGCTGACTATG
TTGATGTTANNNNNNNNNNGTTGATCGATGTCGTCACCGATGGTGAATTAGATGCTGATCTAAAACCATCGGTGTTGGGTCGAANNNNNNNNNNGTTGGA
AGGGCAAGGGCCATTTCCGCCTTGATCACCATCAGGGTTGTTTGAGTGGTTACGGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTATTACGGCCGGACCACCGCAGTTGATCGATGTCTTCACTGATGGTGAACCCGATACTTATTCGAAACNNNNNNNNNNCAGATTTACCAACGGTTGGT
TGATAACGCTCTATAGGGGTAGTTGTAAATCGGCGCAAGATCCGAATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGAATGCCGAGGACATCAAATCTCTTTTGCAGGTTTGGAAGC
TAATGCAAAAGTTTTGGGATCGTTGGTGAGCAACCCGTTTCTTCGGACGCTGCGATCGATACAGTAATTTTTTGGAAGTCTCAACTATTACAGTCGATT