Description :
From Genome Similarity Track
Location :
Scaffold_3385:1441- 2554
Sequence
1113 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCAGCGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGA
AAAGTTCAGCAGAACACGGATCATCGGAAGATCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTCGGTGACTCGAGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAGTGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGA
GGTGGATACGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGTGAATCTTGACTTGCGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCAGTTAAGCCAACACCGTACCGAAAACCAAGCCCGCTAGTCGAAGAAAAGAGAA
AGAAGACGAAAACAAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCCAGCTGGTCCGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGACAGATCGAAGACCCAAGGGAACCG
GTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAATTATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCAACGCAG
AGGATATCTTCGA