Description :
From Genome Similarity Track
Location :
Scaffold_28:144094- 150741
Transcript NameFunction/comments
Phyra_77994callose synthase putative

Sequence
6647 bases(100 bases per row)
GGCCACGGCGAGATGGACCGCCGCCGGCGCGCGAGCTCCAACTACTTCGAGCTGGACGCGGACCGGCGCCGCAACAAGTCGGAGCGCAAGGAGCGCTTCA
GCTCGCGGCTCAACACGATGGACGTGACGAGCGCCAAGGGCGACGACGAGGCGGCCATCGACTACTGCTGCGAGTTCCTCAAGGCCAAGTTCGGGTTCCA
GGAGGGCTCTGTGAGCAATCAGCGCGAGCACGTGCTGCTGCTGCTGGCCAACGGCAAGGCGCGGTGTCTGCCCAGTGACGCGCCCGACGAGCACCTCGTG
CGCTTGGCCAATAAGCTCTTCAGCAACTACCGGGCGTGGTGCAAGTTTATCCACACGCAGCCGGCCACGTACACTGGGGACGGCATCCCGCAGGCTTCGG
GCAGCGACAAGTTACACATGGACGTGATGCTCTACTTTCTGATATGGGGCGAGGCCGCCAACGTGCGACACATGCCCGAGTGCGTGTGCTACCTCTTCCA
CCAGATGCTGACCATGGTGAACGCCGACCCGCAGGGCCGCGAGCGGCAACCGGAAGGCTGGTACCTGGCGCAGGTCGTGCGCCCCATCTGGCGCGAGGCC
AGCAACATGAAGCGCCGCAACGCGCTGGGGAAACCCCTGGAGCACGTCAAGATCCGCAACTACGACGACATCAACGAGTACTTCTGGAAGCAGCACTGCC
TCAGCATCCCCGTGGCGCAGGTGGGCCAGGAGCTGACGCAGAACCACGGCAAGACGTTCTACGAACACCGAAGCCTGTTCACCATGGTGCTGAATTACTA
CCGCATCTTCCAGTTCAACATGATGTTCATGGTGCTGCTGACGGTGCTGGCCTTCGCCGTCACCATCTCGCCCGATGGCGGCAAGAGCGGCTGGGTCCAG
TTCGGCCGCATTGGAGACGTCGTGGAGCCCTACTCAACCAGAGACTTGAAGGTCGCAGTCGTGGCCATCCCCTTCAGCTTGAGTCTCATGGCCTTTCTCA
AGTGTGTGATGGAGGTGTGTCACGGGTGGCACCTGCTGACGTCCAAGGAGTCATCGGCGTCGAGCTCGCGCTCGTTCTCGTACGGGTCGGCGCTGGCCAC
GCGGATCATCTGGAACGGCGGCTTCGCGGTGCTTTTTGGGGTCATGATTTATGTGCCGCTGAACCAGGATAAGGACACGACGTTGCTGGATAATTTGTAC
CCGTTGTGCGGCGCCTACATTCTTCCTGGGTTGCTGGTGCTGCTGACGCAGGCCTTTGCACCTCAGTTGATTAGCGGCACTTTTGCGGCGAAATTCGTCC
GCGAAGGAGAGAGCTGCTATGTCGGACAGGACATGACGCCCCCGTTCTCGTACCAGATCAAGTATATTATCTTCTGGATCATCCTGTGGATCGTGGAGGC
GATCACGTCGTACTTTATTCTGGTCCGGCCGTTGATCTTACCGACGCTGAGCATCTACGACATGACGCTGGACTACCAGAACTCGCTGGTGTCGTTCCAC
AATATCGGCATTATTATCGCCTTGTGGCTGCCCGTGGTGTTCATTTTCAACTACGCCACGCAGATTTACTTTACGATCTTCCAGGCGCTGCTTGGAGGCT
TCCAGGGCATTCTGATGAAGACTGGCGAGATCCGAGGCGCCAAGGAGATGACCAAGGCGTTCCGCGTCGCGCCGCAGCTGTTCGACCAGAAGGTCGTGAC
GTTGCTCGCCCGCTCGAGCGACGCGACTGCTAGCGGCTCGGACTCGACCCGAGCGAGCGCCCTGGCGGCTGCGTACGAGTCGCAGATGATGCTGCGCTTC
GTGGTGGTGTGGAATGAGATCGTCAACTCGTTCCGCGAGGGCGACCTTCTGGACGACAAGGAGGCTGCGATTCTGCAGTACGACATCCGCAGCACTGGCG
AGGTGTTTGAGCCTGTTTTCCTGTCGGCGGGCAAGCTGACGGAGGCGATGGGACTAGCGATCAAGATGGCCAAGGACGGCAAGGGCGAGTCCCAGCTGCG
CGTGACGCTCGTGGAGAACGACTGCCTCTCGGCCATCCGCTCGTTCTTTACGGCCAGCATGTACGTCATTAGCGCCCTGTTCGGCAACGACGACGCTGAT
GTGATTGACGGCTTCCGCCAGCTCGAGGAAGTTGCCGCGGCTGGAGGGTTCCTCAAGTCCTTCAACGTGCGGGAGCTCGCGAGTCTGCGCGTGGCTGCGG
TGGACCTCCTTGAGGAGATTTTGGACCTGCCGGACCCGGACGTGCAGTCGCAGCACATCCCGAACGCGCGCGTGCACTCGATGGGTGTGATTCGCAACTT
CGTGGCCAAGATGGAAGCGTTCCTGAACGGTGTGCAGTCGTTCTGTGTGGACCCTGCTCTGCAGCGCAAGTTCGCCAACTCGAAGTTCTGCTCGAGTGCC
AACGGGTACATGTATGCCTCGCGCGGACTCGTGAACCTGTTCTGCAGTGACACGGCTATGGGCGCTGCTACGCGTGCTTGCCTGCTGCTGTCGCTGGACC
GCTCGGAGGCCATGCCACGCACGACGGAGGCTCAGCGTCGTCTTGGTTTCTTCATGAAGTCGCTGGTGATGGACATCCCCCAGCTGCGTTCCATCAAGGA
GATGCGCAGTTTCTCGGTCGTGACTCCGTTCTACGCCGAAACGGTGCTGTTCTCGCTCAAGGACCTGAACGACCCGCTTGTGAACCACCCGATCTTCCAG
AAGGTGGAGGAGGACGGCAAGAACCTGACGATTCTGAAGTACCTGACGAAGATCCACCAGGAAGAATGGGACAACTTCTTGGAGCGAGTTGACGTGAGCT
CCGCCGAGGAGGCTCAGAAGAACCACCCCGAGGAGATCCGTCTGTGGGCGTCGTACCGTGGCCAGACTCTGGCGCGTACGGTGCAGGGCATGATGATGTA
CGAGGATGCGATTAAGATTCTGCACTGGCTGGAGATCGGCTCGAGCCCTGGCAAGTCGGCGGAGCAGAAGCAGAACCAGCTGCAGGATATGGTGCGTCTG
AAATTCTCGTACATTTGTGCGTGTCAGGTGTACGGTAAGCACCGCATGGAAGGGAAGACGCAGGCTGCCGATATCGACTACCTGCTGCGCGAGTACCCGA
ACCTGCGTGTGGCCTACGTGGACACTGTGGACCACGAGGACGGCGAGAAGTCGTTCGATACGGTGCTGATCAAGAGTGAGTCCGATGAGATCGTGGAAGT
GTACCGCTACTCGCTGCCTGGTGATCCGATCTTGGGCGAGGGTAAGCCGGAGAACCAGAACAACGCTGTCCCGTTCACGCGCGGCGAGTTCGTGCAGACG
ATTGATATGAACCAGCAGCACTACTTCGAGGAGTGTCTGAAAATGCCGCAGCTTCTGTGTACCGCGGACCTGCACCCGTCCAAGAAGCCGGTGTCGATCA
TTGGCATGCGTGAGCACATTTTCACGGGTAACGCCAGTTCGCTTGCCAAGTTCAAGACGTGGCAGGAGCTGGTGTTCGTGACGCTATCGCAGCGTGTGCT
GGCTGACCCTCTGTACGTGCGTATGCACTACGGCCACCCGGATGTTTTCGACAAGGTGTTGGCTATTACGCGCGGTGGAGTGTCCAAGTCCAGTAAGGGT
ATCAACCTGTCGGAAGATGTGTTCGCTGGGTTCAACACGACGCTGCGTGGCGGAGTCGTGACCCACGTGGAGTTCATGCAGTGTGGCAAGGGGCGCGATG
TGGCTCTCTCCCAGATTTCCATGTTCGAGGGTAAGCTGGCCAACGGTGCCGGCGAAACTTCGCTTGCGCGTGAGGCCCACCGCATGGGCCAGTTCATGGA
CTTCTTCCGCCTCAACTCGATGTACTACTCGCACACGGGTTTCTACTACGCGACGTGGATGACGATTGTCACGACGTTCGTGTACATGTACTGCAAGGTC
TACATCGCTCTTTCGGGCGTGCAGACGCAGATTGTGTACAACATGAACACTACGGAAGTGATCATGGCCAACTCGTACAACTACGGCTTCGACGACCGTG
TGTACAGCGACATGGACTCGGTGTACAACACGCAGTACTACATCCAGGCCGGTCTGTTCCTGTCGCTGCCGCTGATTTGTGTGTACTTCGCTGAAATGGG
TCTGCGCCGCGGACTGGTGCAGTTTTTGGAGATGGTGTTCACCGCTGGTCCGGCGTTCTTCATCTTCCAGCTGGGTACGACTATGCACTTCTTTGACAAC
AACTTGCTCCACGGTGAGGCTCAGTACAAGGCTACGGGCCGTGGGTTCAAGATTACGCGTGAGACCTTTGTGCTGCTGTACAAGGCGTACGCCCCGAGTC
ACTACCGCAAGGCTATGGAGCTCGTTGGCTTGTGCTTGGTCTACTTGGCGTTCGGCAAGTTCGACATTTGTGACACGTCTGTCGCTGGCGAAACGAACTC
GTTCGCCTTCGACTACTGTGAGACGTCGCAGAGCTTCGGCGTGCAGACGTTTGCCATTTGGGTTATCGCGGTGGTGTGGCTGGTGTCCCCGTACATTTTC
AACACGGACGGACTCGACTGGGAGAAGACCAAGGCTGATGTGACTGCGTGGGCCAAGTGGATGTACGCCCCCGAGGACTACCAGGACGTGGACTCTGTCA
TGGTCGGCGGTTGGATCGGCTGGTGGAAGGGGGAGCTCAAGCTGTACCACAACACGAGGCCGATTGCTCGATTCACAGTCATTCTGCGTGAATGCCGTCA
CTTCCTGCTCATGTGGTACGTGGTGGCACTCGAGTGGGAGCTCATCTCGGTGGGCTTGGTGTTTGCTGCGTCCGTGATCACCGTCTTGGCCATGGGTCTC
TTTGGCGCTGCTGGCAGCTGCTTCCGCGGCGTGAACACGTCGATTCGTGCGATCACGTATCTGTTCGTGGTGGTGCTCGCGCTCATCGTGTTCTTCGTCC
TCACGATTGCTATCTTCGACGTCAGCTTCACCAGGACGATCTCACTGTTCTTCGGCTACCTGGCGGCCCTGTACGGCATCAACGAGATGGCGCGTATGTA
CAGTTTCGCCAACTCGTCGATCGCTACCGTGGGCATGTTCCAGCAGCTGGCGTTCTTCTTCGACTTCATCTTCTCGGTGACTATGATCATTCCGCTTCTC
GTCATGTCGGCCATCCCGTTCCTGAACATCATCCAGACACGTATGATGTACAACAAGGGCTTCTCGGAGGTCGTGTCTGCGTCGTCGCAGTACGCGTTCT
CGCTGGCGGCCTTCATGGGCGTGCTTGGCGGCATGGGCTGCGGCTGGCTGTTCCACCTCTTCACGACACTGGAGAGCACGGCTGGTTTCTTGAGTTACGT
AACGACCTACGATCTGCTGGACGGCAACGTCGGTGACGGCTCGGTCACGTACGCGTTCTACTTTGCCTGCATGGTTGGCGTGTTCGTGGCTGGCTTCATC
AACTACTTCATTGGCCGTCGCCTGTCAATCGTCTTCGGCGGGCTGCTTACTGTGGTCGGCATGCTTGGCGTGAGCGCGGTGCAGTCGGGTGGCGAAGGCT
TCCTGATGCCTGGCATTTGCTTGCTCGGCGGCTCTGTGGGCGTGCTGCTGCCTACTTTGGCTGTGTACATCTACGAGATCTCCACTCGCGACATGCGTGG
CAAGGCTCTGCTGCTTCTGGGCAGTGGCTTCATTCTTGGCATCTTGTTCGCGGCTTGGTTCTCTTCGTCTTCGAACGAGGTGGGCTGGGTGTGGCAGGTG
TTCATTGCGACCATTATTCTGTCGATCATGACCCCGGCGGTGTACATCTTCCCGGAAAGCCCGTACTGGGTGTACATGCGCGAGGGCATGGAGTCTTGCG
AGCGCTGCCTGGCCGTGCTGCGTCGTAAGGAGGGGGTGTCTGAGGAGCTGCGCATGATCCGCGACGAAGAGGCCGGCAGCGACGACGCGAGTGCCAACAG
CGGAACCTCGTTCCTCAAGTTCATGATGGGCCTGTTCCTGATGCTGGTCTCCAGTATCTTCCTGGGCTGCGTCAACATGTACCTGTCGGACGCGTTCCGC
AGCATTGAAGACGCGACGTACATGTTCGTGAACTGCATGGCGCTTCAGTTCCTGGGTGCGCTCTTCTCGTTCTTCTTCATGGACCGCATTGACCACAAGC
GCATCATGTTCTGCACGCTGCTGCCGATCGCCGCGCTGGTGTTCGTCCTGGGCCTGAACGCCAAGTCGGAGTTTGTGACGGGCGACAACGAGTACTTGAT
GCTGCAGATCGTGGGCCTGCTCCTGTACTTCTTCGCGGGTCTGGGGCTCACTTCAGTCCCCTGGGTGTCGTGCGTCGGTCTGTTCACCACTAAGCAGCGC
GCGGTGTACGTGACCGTCTACTTCATGGTGTTCTTCCTGTTGCCTGTGTGCGCCACCTACATCCGTTCCAACGAGTCGATGAGCGGCAACGAGTACTTGT
ACCTGTTCGCGCTGGCTGGCTGCTGCGTGGTGGCGACGGGTCTGTTGTTCACGGTGGGCACCCTCAAGAACGGCATGGTGTGCACCAAGGGCGAGATGGA
GGCCGAGCGCGCACGTCTGCGCCGCATCCGGGCGTCTCGGCGCAGCGCGCGCACACCAGGCAGCGCGCGCTCAAGGAACTTCAGCCGCTCGCGTGCCAAG
TCGCACTCGAACTATCAGATGTACGAGTCGCCTGCTGGCAGCGCGCC