Description :
From Genome Similarity Track
Location :
contig_5:144087- 150222
Transcript NameFunction/comments
g1638.t1hypothetical protein
g1639.t1hypothetical protein

Sequence
6135 bases(100 bases per row)
TGCGAAGTCTTCCGTTCCGACTGCTAGCCGTGAATGATGTGGATGTGCGAGATGCCGGTCGACACAACTGGCACCAGCCCGGTGTCGTCGAGGACTCGGA
GCACGAGCCGCTGTGGAGATCTCCGCCGTAAGCACTGCGAAGCCCCGCCCGCTCGTCATAAGGTCTCTCTCCTAACCTCGTATTCCATGTGCAGCAACAG
CTCGTACCCGCAGGAGCTAGGGCTGATTCTACTGTCAGTGGAGCCTGTGACGATCAAGAGTGTGCGGGTGAAAGTGGAGCTTACGCGAACGCCAGCTAGA
CGTGAGTGTTAAATTCGGACTCAAGCGAAACAACCTTTCTCGAGTAATAATTGCTGCTTGTTTGGCCAGTTGAAATTTCGGTTGGACGACAGAAAGATGT
GGTTGCTTCTGGCCATCTCGATGCAGTGTCTCGCTATTTCAGTGCGGACTGGACACCAAGCTGGTAGGAACATTTTACTGTGTCGGTGCGGCTCACGAAT
ACTGATGGTCTGATAAAATTGTCCTATAGCGAGGTCCTGATGTGGGAGGCGCGGATGGACATACCACAAGCAATAAATCCCAAGGCTGTTCGTCTTGATG
TGTCAGACTGTTCGTTCATTAGACTCGTTGTGCACGCGCCACACGAAAGCGCTTGTAATCGATCTCACGAGGTGCTGCTGCATTTTTGAACTGCTGTTGG
CATTTAGTTTTCTATACGTGGCTGACTTTTCTGCCTTCATGCAGGTCGTACTGGAAGATATAGAGCTGTTAGGGCTAACTGGAGGTACATCTTGTCGGGC
TCGAAAGCTGGACCCAAATTTGAGGATAGTCGACAGGCAGGATGGTCCGTTCGACCACTGTTTTGGTCGCATTCGCCGCCCCTTATTACTTTCTCCGGAC
AACGATAGTGACGAGTTGCAAGCTGTTTTTTTGGATGCCGGCGTACCGATGAGTATCGTAGCCCAGGTTGCCACGATCCCAATCGTTGAAGCTGTAGTAT
CGGCTTCAGCGCATAAAGGCATCAAGCCACTTGCTGGAGCTAGTGAAGTCGTTCCTAAATCAATCCCTCAAGATAACGAACTCACCGGCGTCCCAAAGAG
TGACAGTGGCACCATTGCGCCGCTAATAGGTCGCGATAGCAGCGACCAAGACAGGGGGCCAACGTCACCTTTCGACCGAGCGCTCCGACAATATATCGAG
CAAACAGCTCGTGAGAAAGCTATACTCGAGAAAATTCTTGCCACTGAAATCTGCGTGACCACAGACGACGTGGCGAGTTGGCAATCTCCCACGATATCAC
CCACTGACCCCACTAACAGCAACGAGATCACGCTATACACGTTTGGAGAATTTTTTACACAATGTCTGCTCTGTGGTGGATCCGATATCCAAGTAATGTG
TGTACAGATGGCTGAGCGCTTTGCTCGACTTCTCAAAGACGTCGTTGGTGCAACATCTGCGCTCGAGGGTATCGTTGCACTTATCATTATAGGTGTTCGG
GGGGCAAAGTCTTCTCGTGTGTTCCGCGCAACGATTCATCTAGCACACACTGTGTTTCTGACTAAAATGGCAAATACGAAGAAGACAACATCACAATATC
AACCTGTGGGTGGCAATACCCAGAATACAAATGACCCTGCAGCATCTGTCAGTACGTCGTCGCTAGGGCTAATAGAGGAAGTTGGTATCACCAACGTGAG
CTATGGGTTGCGAATCATTCTCGAGTCAACACTTGCGAGCCAACTTTGTTGGTCCTCCATTAACCACGCTAGCAAGCCAACATTTCGTTCGAGTACCAAC
CCACACAGCCGGAAAGTTTCGGATGGGCTTCCTAAATTGCCTCCGTCAATCGACAGGGAGTTTCTGTATTTTATCCGGTCGCTGATCGAGCAAGATCTAA
CACGTGCAAGCTTTTTCGAAGAGCTTCTTGGTCTTACTCCTACCGACAGTGCTGCCGGGGTCATTTTCACGACAAGCCGATTGCGATTGCTTCGGTTGAT
CTTGCGGGATGACATGATTCACTGTCGAATTTCAACCAACGTGAAGGCCAGTATACACTCGCTTTGCTCCAACTGGTTGATGCCGAAAAGGTCTTCATCC
CGTGCTCTGGAAAATGCAAACCTTGATGACAAAGATGCAGTAGTAATACGACTTGCTTCGGAATGCTTAAATGAAATAGACCGATCGTCTTCAATTTCTC
AACAAGCCAAGGATAACGCCAACCTTGTCAAGGGTCTATTGGTCGCTGTGCCCAAACACCTGCAAGTCGCAAGTATTCTAAACAGACATCGCTCCAACTG
CCACTATCACACTGCTGACTTTGTTCAAGACCCGCTTACGGAATTGGAGATTGCTGAGTTTGCCAAACAAATGCAGCGATACTTTTCATCCCAGCCTCGT
CCGAGCGCCCTGTATCGGCACGTATTTGTACGTGCACCTCAAATTATTATAGAGAAGGATGAAATGGAGCAATGCGAACTGTTTCAAAAAGGCAACATCA
CTTTCCAAGGGCAAGTTGTTGCCCGAACACCACCGAAAGAAACTTTTCACGAGGAGATTCAACGAAATGCAGCTTCATTTGTGTTCGACGTTGGTACTCC
AAGCAGCACGAAGGTGGCTGGTACAGCACCGCCACACCACCAAGAAGTGGTCTCGAGTTTTGCAGCTTTTCGAGGAACAATCGAACAGCGTAGCGATCCC
CCCAAACAGACGCGCAAAGTTTCCCCCGAAGATCACTTACAACCTCCCAAGACCACCAAAACTCTAGCGGTGACAAGTAATCAACCTGGCAAGAATGCTG
TCAGTACAGCAACCATGATTGTGTCAAGTGATGCAACTTCTGCTGCTGCTGCTAAAAGCTCAGTTCAGGTCGTAGAAGACTCAACCAATATTGCAGATAA
CACACTTTTACAGGAAGTACCTGCTGTAGCTCCAACCACAAGCACCGATTCAGTTTTGCTTCCTGTCGCTGTTACACAAGACCCCACCAAGCAAAAAGCA
ATTCCCTATCAGCCTGAACGGGCCAAAGTCAAAGGCAAGGAGAAACGCAAAGTCAAAAGCGGTGCTAAAGATCAAGACAACTGCGTACTTCAGTAACAGG
CTATCAGCAGCAAGCTAATAACCAGTGCTCTTTCGTGATCGATAGCTTTGTACGCTCTGATTCAAGGAAAGTTCATATCGCTCCTGGAGCTCCGTTGATA
GCTTCTTGACGTAATGTTTCATTATGAATTCTTCGTCAACGTCACAGCAGAGGGCAAGTACTACCTGCTTAGCAGCTTCGCGGATAAGGGAGATTTCGTG
TTGAGCAGCGCCGCTAAGCAGCAAAAAGCGAAGGATACGTCGGGGCGCGATATCAAAACTTGCACAACAGTGAAACGACAATAGTAGCGCTGCTAAAAGC
TTCAAGATCGCTAGAAGCTGCTGGTCTGAGTGTTGGAAGTTTCTCCTCTCGGCATCTTTTAGAGTGAGGTGCGTCACGAATGTCCCTCTTGTTCGTGTTG
TCCCAGCGACCTATACACGTGTTTCCAAACTAGCGTAAATTCACTGCGTGGAGGCGTAAAGATTTTACGGCGTACCTACCTTCAAAATAGTGAACGCAGC
AACATTGCGAATTGGCGCCTCGCGTGCGCCAAGCCTGTCTGTAAGTCGGGCAACAATTTCGGTAACCTATATCACATATCGAGCATTTCATGAGTTGTTG
CTAGCTCCAGATACTGTAGTCCGAAACTAAAGTACTACTGACTTACATCCAATTTTGAAGCGGCTGCATCTTGGAAGTATGGTAAACAAGTTAATAGTGC
CCGTAAAAACCCGCAGCCGGCGGCAAATACTTCGGCGTTTGTGTCATCCAGAACTACAGCCAATATCTCTAACGCTTCTGCACCCGTTATCGCAATTTGG
CAACTTTGATCTGTTACCTGCGAGCACTCTGCAAGCTGCCATAGTAATGCTTCTCTCTCTTGCCACTGACTTATCTTGAGCCTCTTCAGTATGTCATGTG
CTTTAAGCCCCTGAAGTGCTGTCAGCGCATGTTCATCTTTATCGCGCGGTCTCGGCGAAGAGGACATTTTCTGGGATAGCATCTTCTCTAGGTGATATCT
GCGTTGCTCAAACTCAGCAAACATATCGAGATCATTTACATGTTTGGTATCTTCGAGCTCTTTTGTACTTTGCCCAAGTAGATTGATCAAGTGGCTAGCT
TCCTGCTCCAAGGAAATCCACGGCTGTATTTGCTTCTCATTGCCAGCATATTGAACGAGTTGCTTGCCGATCTGAATGTCTGCGAAAATTTGCTCTGGTG
TCTTCATTTTCTGGGTGTCTTGAATCCAGATATCTGCTGCCCGAGGGGATCTCATTTCCCGTTCTTGCGCTGGGCTGGGGGTGGTCGTGTCGTAAAGACT
ATGGACACGACGACGAGGTGACTTTTTTGATGCACTCTTGAGAGGAGGTGGTATCAGTGGCAGCGCCACCTTCGCAATTTTCTGCGGTTCGAAAGCTGCT
ACTGATGCCAATCCAACTTGGCTAAAGAGATTGGTTCTTGTCTGATGGCACGGATGCAAAACCAGACGCAACAGTGTAATCTTCGAAGGTTGGGGAAGCT
GCACCTCCTGAAGTTCGCAAGCAGCACGCTGCGCCTTTTCATTGCTGCGAAAGCACACAAACCCAAGCCTCTCGAATCTGACACCGGTCCTACCGTCGTG
AATTCCATTGCTTGTGGCTGCGGACGTGAAAATCTCAACTCGGGTCGCCACTTTGAACGGGTGCGATAGCAGATTCACCTGCTCAATGCATGTCGGTAAG
CCTCGATTGACGCGAAATACCAACTCTTGCGGGAACTCGCAGAATTTCTCCGATTCCCACACCGCCAACTGGGACGACGGCAAGGTCGATGCGCGTTGGG
ACAGCGTCAGGTTGGCTGCGGGAAAGCGCACATCCTCGCTGGAGCAGTACAGGAGTTCCAGCAGAGAAGAAGCCCGCTCGCCGTCACTCATTACTTCAAT
CAACCAAATGCCAACATGAACTCGGCACAAATGACTGTATTTTGGCACGTATAAATAACTTCAACGGCAACAAAAGGACGCTCACTCGTTTTCCAGAATG
ATGGTTCTTTATGTGTACATACACCAGTCTTTTTTGTTCCAGAAGGACCAAATCGGCACAATTGAAAGCGTCCGCGAATCTCAAGATTTAACCTCAAGTA
GTGGAGAGTGATGCCGACGTTGAGCGACGAGGAGCAGGAGTTGATCCAGAAGGACCGCGAGGCCAACCCTGGCTGCTTCTACTCGACGGCTCTGTCGCAA
AGCTGTAGGTCCATCAACGGCGACAGCAAGTGCGAGATCATCAAGAAAATCTTCCGCCAATGCCCCAACTCGCGCAAAGAGCTCATCTCGAACCGCAAGG
AGATCACCGAGGACGAGCACAGCGGAGAAGCGTCCACCGGCGACTTTTTCAATCGGGAGAGGATGGATCCACGTAAAGGGTACGCGCCGATTGGGACGGA
GCTTTTAGAAACTGAGTGCTGACCGTGGGTTTGATGTATTGTGTTAAGCAGAGGGGACAAGGACTTCTTTTTCCAGCAACGGTATGTTCATTTGGTCTTT
TGGAAGGGGTTTTGGTGTCTGAATCTTTGTTGCTATTTGCTATCAGAGGTGATGACTTTGAGGCCCAAATGAGTCCATTTGACTTCCTTCGACAAGAAAT
GCTTCGTCCATTTGAAGGTACGAGCTGTCTGCTGTTAAGTGAGGAGTTTAGTGGTGGTCTAATGATTTGCTGCGCTATTCGTGCTCCTGCTGCAGATTTC
TTCGGTGGTGGCATGATGGGCCGTGGTGATTTCAATCCTTTTGAAGGTCTAGAGGGAGAGTTTGAGCGGATGCCGGTGCGTCCACCGTCGCCCACACCCA
ATCGCCCTTCACGACGACAGGCTCCTTCCAACCCTCCACACTACTCCTTCCAGCCCTCACAGGGAAAAGGCCCTCATGGTACGCTATTACATGTAGCTGT
TTTAACATTTGTAGTGGGTTACTGTCTCTAATGCTAATTTTGCGATCTTCCTGCAGAGGCCGGCGCAAAAGCGCGCGCACAAGGCAAGAGCGATATGTTC
GCTGACTACTCGGGTCGTGTGGATGAAATTTAATG