Description :
From Genome Similarity Track
Location :
Scaffold_121:144081- 146185
Sequence
2104 bases(100 bases per row)
CGAGACATTGAAGGTATTGGTTAATGACGGGTAAAGTGTAGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAGTTGACTTCGGAGATCACTCAATTG
CCAAAGCTAGAACCGAAACGGTTCTTGCGAGATCTGTGTAGTGGCAAGATCAAGCAGATCGATGTACTCGTCACGAAGGACGAGTACGTGACTGACATTC
GGTCGGCAGTATTATTTACAGAGAACGAACGGGTTCTCAGCAGCTCAGCAGTGGACGAAAATTCCTCGATGATAAGGCTCGGATTGAGAGATACACGTCT
CAATCTTCGTAGTTGCTCCAGGCAAATCCTTTATAAGGATTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAACTGCCTAAGGATAAA
GGCACTCGACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTGGCCACTGCCTCGTAAACAAGTAATTGCGATCAGCAAGCCTT
TTTGCCGATCGCTTAGCTCCGGGTCATGTGAGGGAGTCAACTTCCCCTCACAGCTCTCCGACCTTCTGTGTGCGCAAGGCCACAGGAGGATGGCGAATAG
TGGACGCGTTCATCAAGTTGAATGCTGTAACGGTACCGGCTCTGATGCCGATACCGAGGAAGGACGTAATCATTGATGGTATGTCAAAGAGTACCATCTT
TTCGTCCATGGATCTGATGGATGGCTCTATCAGATCCTAATGCGTGAACAGGACATACCTTACACGGAAGTAAGCACCTCGAGTGGTATGCTTTGGGAGT
GGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCCACCCTCAACAGATGTGTTACAAATCTGTTGAGACCGGTGCGAGACTTCGCACCGAGTTACTT
CGACGATGTATTCGTCTATAGCCGGGCTATGGGCGGAAAGACGGACGTAGAGGTTCATAGAACTCACGTTCATCAGGTTCTTACACTTATGCGCAAGTAT
AAGCTGTATGCCAACCTCAAGAAGTGTATATTCGCTGCTAGCAAAAATACCACTCCTTGGGTGCATCATGGGTAAACACGGCGTACGCCCTGATCCTGAA
AAATCAAGGCGATTACCGACTGGCCTGTGCCAGTCGACGTTAAGGGACTAAGAAAGTTCCTTGGTCTAGCGGCGTACTTACACAAGTACTCGCGCAACTA
CGCCGCGATGACCGTCCACCTCTCGTCTTTTGAAAAAGAACGACAAGTGGTCATGGGACGCTAATTGTCAGCGTTCCTTTGAAGGTGTCAAGCAGATCTT
GATGCAATCGCTCATCTTGGCGATTGCAGACCAAGACAGACCATTCCATGTGGTCTGTGACGCCAGCGATTTCGCAATCCGCTGCGCGTAGATGCGGTAC
GATGCAGACGGCGCATAGCGCGTCGTATGTTATCAATTGCGTCAGCTGCAAGCAGCTGAGCGTAATTATCCAGTGCATGACAAGGAACGCCTTGCCATGA
AGTATGCACTGGCAAAGTTTCGCGTCTATCTCCTTGGAGATAGGCCGTTTGTAGTCTATACGAACCATGCTTCATTACGCACGGCCGTAAACAGCCCACA
CCTCTCGAAAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNA