Description :
From Genome Similarity Track
Location :
Scaffold_20:144046- 146146
Transcript NameFunction/comments
Phyke_g1287hypothetical protein PHYSODRAFT_259509

Sequence
2100 bases(100 bases per row)
TATGCTGTCGTGAAACCCGTCAGATCTGTGTCGAGTGTGGCATACAGCATCTTCTTTAATTCCCGTTTGCTATGATAGAGAGGGAGGTCCAAACGGTTGA
AGCACGCGTGACTTGAAATATACTGGGTGGTGCGGTAAGACACACCTTTGAGGTTGAACGGGCACAGTCGACCATCGTAGCTTGTGAGTCCTCGGAAACC
CGACAGCGGCACGCAGGCAGAACCAGTTGCAAACAGCAGGAGGCGGCGCCTGTATTCATTTGGCATGTGCCTCACGATCTCCCAAAACCAGTTGGTTACA
TTAGCTCCCTCTAGGTTGGGAGACAACACAGCGTGTGTTTGCCAGTCTGTCACGTCAATTTCAGGAGACCCGCACAGCAGATAGTCAAACTCTTCTGGAT
CAAAGATCAGCAGGAGCTCGCGAGGGATGACCTCGTACAATCCCGTTAGGAACGCATGCAGTTGATCCGCCACACTCTCGAAGAGGACGTATCGGAAGCG
TCGGTCCAAATATTCCTGTTTGTTAGCATCCGTCACAGCGACATTCCGTCCATTCGGAATCAAGTCCACTACGACCTTCTCCGATCCGCTGATCTGCTCC
GTCAAACTGAAGTCGAGGCCAAGGTCGTCCACATCATCGTTGTCCATTAACCACCGAAGACTGCGGTAGGCTTCCGGGTCGAGGAATTCCATGTCAGCAA
GCGTGACGGGAACGCCCAAAATTATCTTGAGAAGTGGCAGTGCGAGATGGAAACCCCAGATACCACCTTCTAATAGTGCTCTACCAATTAGGCGACCAGT
AGCAAAATAGTAGGCGAGGTGATCCTCGCCCACCTCGGTGCGCGACTGAGGATTGAGAAAGTAGCTCTGGTCGGCATTATTTGTACAGATAAAGAGGCGC
AGCGTTGATGATGCCAACAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACACCACCGGCATCCACACCACTCTCGTCCAGAAAATTAATGCGCATGA
AGGAACGCAAGTTCTTCGGCTGAATACAGAACATGTGGTCCATAGACTCTTCCAGCATGTACTCGCGGTGTATTGATAGCTTGAGAAATTCGATTTCCGC
AGGAATAATCAGTGCAGCAGTGTTCACCACAAAATGCGCGTACTTTGATGGAAAGTCACTGGTGGCGATCGAGACAATCTCTTTGCGGCGCTCAGGGCCT
GCTTCAACAAGCGTCGATTTACCCGTCGCAAATTCAGCTGGGTCTGCAACGGATGCCTCGACCAGTTCCACTCCCACATCACTAGGAAGGATTTTAAACT
CATTTTCGTTGCTCTCCTTGTCGTCTTGCGGTTGTTCGATTGCCAGCACCGGTTCGCTTTCACGTGCCGGTTCCTCATCCGATCCTCCTTCCTCCAACTC
CTTCAACTCCTTCAACTCCTTCAACTcctccaactcctccaactccttcttctcatctTCCCCCTTCGATAGCTTGAAAGTCACTGTATAGCCAGGCAAT
TGGGCCTCCACTGCGCTACTCACAGGCACGTTCCCACCACTACTGCGGTACCAGAAGAGTTTTCCTTCCACGTCCAATTTCCGCGACCATTCTTTGCGGT
TTCTAGCTCGACGCTGTTGCCGACTAAGCGACGACATTTTGCGAGGCCGTGGCGACATCAAGTGCGTAGGTCTCTCACCACTCGCCACAAGGTGAGCTGG
TGGCATGAAGCTCTCTTCATCCCCGTCCTCcgcaccatcttcgtcgtccgtCGTCATGGACATTGACGACAGTTTGTCGCCACACAAGACGCAGTACTCA
AAGCGCTTGAAGTTCTCGAATTCGCAGCTCGCACATACTGTATAccctgcttctgcttctcttGTAGCTGCGTCTATTCGGTGATCAACTGACTCGCCTC
TgtatgaagcagcagcacgttaGAATACGTTTACTATTACATATAAATCCAGTAGTGATAGCAGCGAACGTACGAGAGCAGTGGTGCTTCGAGGTCTAGT
AGGTGGCGATTACGACGGCATGCCATGAGCCAGACTAGGAAGAATATGACgcatagcagcagcatgccgATACCCTGATACATCATGGATGCCTCCGTGG