Description :
From Genome Similarity Track
Location :
Scaffold_62:144001- 146146
Transcript NameFunction/comments
Sapdi_VS20SDRG_13664hypothetical protein

Sequence
2145 bases(100 bases per row)
GGCTGTGGCTGCGCAGGTGACGGCGCGGGGATTCGACTTGCTCTCCTGTAGTGACGCGGGGGCGCTTGTGGCCGCCAGTTAGGTCCATGGTGACAAGCTT
CATCTCGCATCTCGCTCAGCGGGGCGCTGTCGCAGCGGTCGTGGAGCGCGACGTCAGCGAACGTGCTCGGGTAGAAGGTGCGGGCTATATGGCTAAGTTT
ATGAATTAAGTTAGTCCATTATCTCAGCAGGATATTCCAGATGCACTGAGGCATTGAAACCGGGTCCGTCGTGCTTGAACTGCGTCTTCAGGTTAGACAG
GAAGTGGATCAGTGCTCGAGCGGGATGACGTAGCCTCCCACAACAAGCATGGCGACAGCGTTCATTGCCTTGCCACGATCGGCAAAAAGTGCGAGGTCGG
CCAAGTTGATGCCAGAGCGCATGCACAGCCGCAGGAGCCAAAGGTAGTTCTGTTGCGATGTCGCTCAGCGGAAGACGACATTGTGGACCGCCACGTCATC
TATGCTGCATGTGGCTAGCTTTAGTCGTTCAGTTAGTCGAAACAAGATCTTTAGTAGTAGTAACGGACCGACCTTTCGGGGCCGGAAGAATGCAACCACT
TTCCGATTTGCAAGCTTCCTCGCAAGAAGTTCTTCACAGTCTCAGCGGGTACAAGAGCGACGGCGGGGACGATGTTGCGGCCGTTGGCGTCGCGTTGAAC
AAGGCTGAGGTAGACACCAGGGTCCTCGGCCTTCACGACCGTCCCGTCGGTGCCGAGTACAGACGCATAATGGTGGTGCTTGATGGAGGCCCCGAAGTAA
AAAAAGCTCGGTCGGTAGAAGTGCTTGCTATCGTTGAGCCGCACGAATGTCCTGGAGGAGCCACGGCAGGAACGTGTAGCTCGCGTCACTCTATCACAAA
GCTTGGATGATACATAATCGTGGACTACAAAAGCTACCTGAGCCGTCAGAGACGCAATGACCCCGACCTTGACATGAGCCACGAAGACATCCGGCAACGC
CGACCCACCACCGTCCGACTATCATGTTCCATTAGTGGTTGGAAGGATGGATGCGCATATTTATACCAGGATCGTCGTTGCCAATGCGCGTGCCGAGATC
TAGTGTGCACCAGCTTGTGCACGTTTGCCATGGCCACGGCTTCTCGCACGGAGGCTGTGCTCATCGACATGCAAGTGTAGAGTGCTCAAGATTTACTTCT
ATACATCGGAAAGAAGTTGTGTGTGAGGTTTCCGTTTACATAGTGTCCATCGCGTACTCTTCACGACGTAGTGGACTTTCGCTGTCGTCTTTTTGCGCCT
TCGAGCCTACGGAAGTTGTTCGATTGTCACTCTTGATTGTGCCATCGCATCAAGTAGTACCGTGTTTGGCCACCTTGACACTGAACCTCTTCTGGAGTGC
GAAGAGGCTTCACCGCCTCTTATTGCCTTGCATCACGTTTACTACCCGCTTGGTCTCCATCCTGGTCTGGTGGGGTGGGGTACCTTCGAAATGGCCCACT
TACCCGGTCACGCACACTATTTGTTATATTTACATCAAATAGTGTGAGCTGCTAAACGTGTCTGGACACTATTTAGTGCAAGGGCAACCGTGCTGGGCTG
CAGGAATTACTATGATTCCGTCCAATCAGCTTCGTAATTTGGCCTATTTCGACCAATCAAATGTCTTGGGGACCAAGTGATAATATTGGCAAAAAGTTGG
GGACCAATTGATAATATATCGCCAAAATGGGGACCAAGTGAAAAATACTCTGTCGTACAGTGCAGGAGCCTGGTGCTGGATCCCACGTGGCAGCTTCGTG
TGCCACCCTTGCGTGCGTCGTTGAGGTAAAGATGACGCGCGCGTGTGTGCGGACGTGTTTCTCCTTCAAGCGCGACGTGTCTATTCGCCGCGCGTTGCCT
TCAAGCTGGTTTCTTTGCACGTTGGCGGCAAGCATGCGTCAGCACGATCGAACTGAGCGCGATGGGCCAAGAACCGCTTCGTCGCATTGCTCGCTCCCTA
TAAGAACTAGACTTCCATCAGTCCAAGCAGCCAACAACATGTTGACGTCATGCGTCGTCTCTCGAGATCACCCATTCTTGGCCGCGCCTTTAGCTCCATG
ACGTCGAGATACGGAGACATGGCAATGAAAGTGAATAAATTAATT