Description :
From Genome Similarity Track
Location :
Scaffold_965:1440- 5091
Transcript NameFunction/comments
Phymu_g12446hypothetical protein PHYSODRAFT_327692
Phymu_g12447hypothetical protein

Sequence
3651 bases(100 bases per row)
CGTTGTCACGcaaaacagcttcaacaacgcTCTTGCGGATTTCTAGGCGCCGAACATTCTCCTCGAGATACCGCTTGAAGACTTCCCATTTTTCATTCAC
CTCCAGATAGTCTGCAATGCCTCCTTGAACAACATCAAGGGCCATATTGGCGGTGCGTGACACCATCGCTATGTGTCGTTGCAATGTAGTGTCAGCAGGT
TGCAATAGGTTGGAAATATGGTTGGGTGGAGCCTGTCGCATGGCAGCATTCCAAGTAGATCTGTCCACGTTCCTAGTGATGTGATTCGCCCACATCCCCC
ACACCATTGCGTCAGCTTGAAATCTGCCCTGCCATATATTCTGTAGGCTTTGTACTATATCTCTCAACGAACTCTCTGCAGTTGCGCCTGCGCGATTGGT
CTCTTGGGGTTGgagacaagcagcagcaaacgctTGTTTATCTTGAGCTTTTGCGATCGCCAACCCGTACTCGTAGATCACGAGCGTTACGCTGTGTCCT
CTCATTCTCACCAGCCATTGTTTCCACTCTATGTCGGACTTCGCTGAATCCACCACTTTTTTCTTAGCCCGAAATTGCAGCACCCGTTCCCATTCACCCA
CCTCATGAGTCTCTTTAGACCATTCCCCGTTTGTTTTTACTGCTCTTCCCTTTACGCGACAACTGAAGAGGTTCCAAATCTTGTGCATGATAGCATTAAA
CGATCCCCCGTTAATGACAACGTCATCAAGGACTTCAGCGGATGTGTCGCGCTCGGCAACCGTTGTCTTCAATATTgggtggagaaggagttggTACAGG
TGTTCGACAGTtgaatcttcttcttgctcaacTGTTTGGCGAGCATctcgtgctggtgttgcagttATCGGTACTGGAGAAGGCTCAGTTGCAGGCATCG
GCGTTGACGAAGAGGACACGCGTGTGGTTGAGGGTGGGAGATGTTCAGGTGCTCTGGTGCCTTCTTGACTGGTGTCTCCCGGAGTGGCTCGTGATTGCAT
CCTTCCTGTAGCCTGGGGCTGTGTCGGGGTATTGCATGGTGTAGGTGTACGACTACGAAGCTGGTAGGGAGAGGCACGTAGCCGTGGTGAACGGTGCGGG
GTGGCTGGCATCGTGTGACCcggaactgcagcaaatgAAGTCACAAAGGAAAGCAACCTGGAAGCCTCTAAACGGGCAGGGCTTATGCTTTACAATGAGT
GGATCAGTTAGTGGCTACATTTGACTATATCGATTCAACCATTCGCTTCCGGAAATTTTGAATCAAACTCGCAATATTATGGTTACATAATAGatccaac
ttcaacacgttgcCGTTGAAGTTAACTGACCATGCAAATCCCACAGGATAGCGACGAAAACCTTCACAATATCAAGGAAGACCCTTTATTAGTGACTGTA
ATGTCATTATACACAATGGTATACCTGCATACACGGTCAGTACCGCTTTGTCGGCGCTTATAGCGCTTTAAGATGGCGTTCAAGCTTTGATTCTTTGGTT
GTAGCAACGTAGCCTTCTACCAACGTGCTCACGTCTTTGTGTAGTGCTGCAAGAGGCTCCCACGAGTCCTCAATTGCCTCTAAACCATGTCACCCGACAA
GTATCTCGTAGGAACGACTGTGGTCATTCCAGCGATGCTCCATCAGCTCGCGCACGCGAAGCATGATGACCTGGGCAGCCACGTGCTCCAGGAGTTCCTC
CGTCACATCAAGGTCCTTGTCGGCGAAAAACTTGAGCCGCGAAGCGTGCACATCAAGTCCAGTCACAAGGTGCTTGACCTTGAACGCATTGCGCACTTGT
GCTGCAATGACCGCGTAAGGGCCGACCCACgtgacgagcagcttgtTTTGTCTTTTCTCGTCCACTCGGGACCGCAGTACATAGTCGcccacgttgaagt
tgaccaTGTTGTCGCCTCGTTCTCGTTTCTTGTTTAGCAGAGTCTGCTtgagtcgaacgtctgcaaCTGCCCTGTGTATATCTCTTACACTAGCACGTAA
GCGAGCCAAGCTAGCCTCGATCTCATCCGAGGTTCGCGTTGGCTGCACACTGGGAGCAACCTCGGGCCCAAGGTATACCGCCCGCAGTGGCGAGGGAGGC
TCCAAACCAGTGAACAGCTCTCCCGGCGTCTTGCCTGCCAGCGATGGGACCGCAGTGTGGTTGAGACTGGCTTGAACGACTGGTATCAGTCTTGGCCACT
CGCGGTAGTTGAGCTTGTAGTCTAGAATAAGAACCCTTAAGACTTGCAGTATGTCTCGATTCACTCGTTCGACAGACCCGTTGATCCATGGGCCGTATGT
CGGCGAGAATATCTGCTTACACTTTATTCGGGTGCagagctcctcgatcacTTCGTTCTTGAAATGCGACCCTTGGTCGCTAATCTAGTCTCTTGGTATG
CCAAACCGACTGTGCCAGTCCATGATAGCATCAGCTACAATAGTACCTGTAGGTACCTCGCACTTGACGAGCTCACAGTAATGGCTTGCATCATCTTTCA
GCACCAACAGGTATTTCAAGTCTCCAAAAGATTCACCCAAGTAGAGAAAATCCCAATGTAACTCTTGGTTTTGCTCACTGCACCGGTATGTTTCGCTCCA
AGGCCTTGGCACTATCTCTCCCCCCTTTTACATGATGGCACAGGAGGCAGCTCGCCAAGAACCTGTCCACGCATTGTCTTAGGTGGGGCACATGGAAGAT
GCGGCCTAGGTGCGCCAGCATGGCGTCCCTGCCGCGGTGGCCCTGGGGACCGCAATGTGCTATGATACACAAGcggcgaagcagctccgtggCTTCGGTT
GGTACCCACAGCTTGTTGTCATTGCGTCTGACTCCACTGTCACCTTGCTCGAGCTTTGCCGAGACCTCCTTTGTTCCAAACCTGCGCTGAGCAGCGGCAA
TAGTTTCCAAGTTTGGCCACACGAAGCCTTCCTCGTCTAGAGGTCGCAGCAACAATcggtcttgctgctgttgaccGCGTGTTATCACTCTACGCAGGCT
TGTATTCGCTGGAACCCTTGCCCAACGCGACACCATTTCTGCCCAAACGTTTTCTTCGCCGGCGATGTGATGAATGTCATACCGAAACTCTCCAAGACGC
ATTGCCCACCGAAGTAATTTCCACGAatgtgcttcttcactgtgTCGTGTGGTGCGAATACATGGATCAAGTTGCGGTGGTCGCAGTATAACCGAAACCC
CGCTGGTCGTAGAAGAAGGTATGGTAGTTTATCACAAGCTGCCACAATTGCAAAAGCCTCCTTCTCTATCACGCTCCAGTTCTCATGTGATCCCGTGAAG
GTGCCGCTCATACAGTGTAGCAGTCGATGCTTTTGATCTGCTACCGGTTCGTCACTCTTCCACGAATCCACATCGGTCACAATCACACTCCACGCTACGT
CTGAGGCGTCCGTGAACACGGACAGCACTCCGTCCGGACTAGGGTACGCCAACGTAGCCGCAGTAGCTAGACAGTCTTTGACTTTCTGGAACGCTGcacg
ttcttcatctgtAAAGGTAACTGGTAGCTTGGTTGCAGCACGCTTCGTTCGTTTTCCACTTCCGAGGGTCGTGTCAAGGCGCTTTTGCAGTGACTGCACA
TGGCCAGCATAACTAACCAAACTGTCTCTCATCCAGTTGCATGCACAAAGG