Description :
From Genome Similarity Track
Location :
Scaffold_342:1440- 4500
Transcript NameFunction/comments
Phypl_g7205hypothetical protein

Sequence
3060 bases(100 bases per row)
TAGTGCTAGTAGCACTACTAGTTTGGGGAACTTCAACCGACGTAAAATCTTGAAAGGACGCACAAACGGGTGGCTATCCAACCCCCCTCTTCCAATCCTC
GCTCACTTCTCGAAGCTCCACTCAAGAACCACGGACGATGAAGTGCGCGAAGGTTGACTGCAGTTGGGGAGACTTGTCGGAGACTTCTCCTTGCTGTGTA
TGCGGCCGTCAGGTGCATCACTTGTGTAGCAACGAGCTCTGCACCGAAGCTGAGCTCTCTAAAAGGTAGCTCTGCAACTGGTACCGAGTCATCCCCCCCG
TCCTAGTACTAACAGGACCACTGTGCAGGTTTTGCAGCCGTGCATGCGTCCGAAAGTTCTTCCATTCTGAGAGCGACTCCCAGGAGCTCACACCGAGCAG
TCTCTCCGGGATATCGCTGGCGAGTGACACGTTCATAGACCTCGCACAAGATGACGAGGAGAAAGAAGCAGACACCGCCAACACTATTCCGGATCACACC
GCCCACGGTCCTCCCAAGAACTCGAGCGATCCGATTTGGGGATTGATACGTCGTTTCGAGGAGCCGGTCTCGTACAAGAGCAAGCAGTTTACACACATTT
GTCTACTCTGCCTAAAGGCAAAGAAAGACATGGAGACACTCACTCTGCCGTGCCAGCAACGCAACCAACGCTAAGTCTCACTTGGTAGCTAGTCACAAGG
AACACGAATTGGCtatcaaggagcagcagtaTCGGCTAAGACGTGCGGATCGTTTCACCGTAAATGTGGTGGCCAAACGAGCGGCGGAGCGGACTGTCcc
tgctgctgaaccaaACCCACGTGAAGACCAGCCTGCCAAGCGCAGGAAAACGTGGTGGAAGACGCCCGCGAGCCAAGACCAAATATCGGGCCACATTGCG
CTGTGGCTGATTCGTGATGGTGAGCGTTATTTAATTGCTTTATCCTCACCGGTTTTGTACTCTTACTCTTGCATTATGTGTAAATAGGATTGCCGCACAA
CATGGTGACAACTCCAGCCTTTCATGATTTTCTCGTCGGCGTTACAAGGGACCCGGGCGTCACTATACCATCGAGCAAGACCTGCAACGATATCCTCGAT
AACCACTACGATAAGTTCGAGAAGAACGCCTCCGAGTTGTTCGCCGAAGCGTTCAAAGAGCTGCACGAAACACCGTTCATGACGGTAGAGTATGATCTCT
GGACAAATAGCTCCAAGAACTGTATTGTTGGCGCTTCCTGTAGTTTTATTGACCAGAAATGGCACCCAAGGCGTATagcgcttcttggagaagtGAAAAC
TGACGGACACGACTCAGAGGATGTCGCTCCACTGTTGGATGAGCAATTGAAGGCTCGCTATGGTTTGGATGTGAACAAAATGGCGCGATTTACGATCtca
gacacagcagcagcagcacggaaAGTTTCGAGACAGTTTGACTCGACACTGCAAGCAGATTGTGCGATGCATGTACTCAACCCCTGTATTGACTACAGTA
TAGGACTGAAGGAGAACATGCGCAATGAGTACAAGAAGGACCCGAAGACTAAGGCGTTTGTCAAGAAGAGGATCGTAGTGACCGACGGCGGAGCATTTCC
GGAGGGTGGCGCTATTGTTCGTAAGTTGCGCGCTGTAAACAACTTTTTTGCGTCTAGCAAATCACCGGAACGTGTTGCCCGCCTCTCTGAAGTTCAAAAG
TTTCACAAACTGCCTCAGTTGGCAGCTCTGATCGACATCGACGTTCGCGTGGTATCTACTATCAAGCTGTTCCGGCGTTCAATTATTAATTATACGGTAT
TCCAGGCGTTCTTCAGAACGCAGACGTGGCAAAAAACGTGAAGGACGTCTTCAACTGCATTACGGACGGCGAATGGGAGCTAGTAGTTCAGATGGAGGCA
ATAATGCAGCGAGTAGCAGAACTAGCGCTGGTGGAGTCTCAATCAGCAACCATGCTTTCCTCCACGatgtacgtgctgctgcgtgttgCTTCCGCCAGAA
TGAATTCCTACAAGTTTTCAGCGTACTGCTCGTGATACGGAGACCAACGAAAAAACCTTCCCGCGAATTCAGCTGAAGTTGCCCGACTTATCTACGTTGG
CTCACCATTGTATTAGGCGTACACTGCATCAGATAGCCGAGCGGCTACCAAAGCCGTCCATACCAATGGGCATGGCCCTACTTCTCGACCCCCGGACGAA
ACCAGCCGCCAAAAATTTCCTGCGCATTCCTGACTCAGCGGAAGCATCCACTAACAGGATTCTGGAGGAGGCAAAGACGCTAATGCGAACCGAGCACAGG
GTTTTCTATAAAGCCCTATATGCAAACGCGGAGCAgggagatgaagacgcgtcttctgcttcaaGTTCACCCCGTGGTGAGTGCAACAGTAGCTCTGATG
CTGAAGTGGAGTTAGTGTACGGAGAAGAAGTATCTCAACCGGCTGAGGAGATCactgctgatgctgcacTAAACGCAAAGGCTGATGGGATATTGGGGGA
GTGGATCAGCCTTCGAGTCGAGTGGGCCGATGTGGTAAAAAGACAGTATCCAACCAAGGACGAATGTGAGAAGGTTTTAGCCAAGCTTAGCGTGCGCGAC
AAGAAGTGGAATGTTCGCGTCTGGGATTTGGAGCAGCTATGCGGGAATATCGACGTTTGTCGATGGTTTGCTGAGGTCGGCGAGGGCAAGTATCCTTCCA
TTGCAAAACTTGCGCGCGTCTGGCTGGGTAGGGGTTGCTCGACGGCGTTTCAAGAACGCGTATTCTCGACAGGTTATTTTGTGGTGAGCCAACTGCGGAC
AAGGACGGACAACGAGCGGGCACAGCGGCAGCTGATACTGCGCCACAATCGCCTAGAGCACAGGCGCACGGAGGAAAGCAAGCGGCAGCTATGGTAGGCG
CCGATTTATTCTGGCTAATACCCTACTACtagtactagtagtagtGATACTACTAGCGCCATTACTCAACTACTGCTAGTAGTAGTAAACCATTTTCTCA
GAGTCGACTAGCAGTAATAGTAGCATACTAGTCCAAAattctcactactaccaaaccctg