Description :
From Genome Similarity Track
Location :
Scaffold_1401:144- 7090
Transcript NameFunction/comments
Phyta_totarag12889hypothetical protein PHYSODRAFT_338895
Phyta_totarag12890hypothetical protein
Phyta_totarag12891hypothetical protein

Sequence
6946 bases(100 bases per row)
gcGAGACAATACTACCATGCGCGCAAGAGGCTCCGCGAGAGTACCTCTACTGACTTAACGTAGCTGGTCTGCGAGCACGGTTGAAGGTCAAAGCTGGTGG
GGCGAAGGAACGCCGAGAACATGTCGGCCATTTCATCGAGACACTCGGAGATCAAGATCTGGCCGATCAATTGACGTTGCTGCGACTGACAGATGCCGAC
GAGCTAGAGGATGTCCTACGCGCCCGTGAAAGGGCCAAGAGTCAACTGAAGAAATCAGCCTTTGGATCTAACAAATACCGACAGAAGtcagctgcgccag
ctccggcCGCACCAACAAAGCAGGCGGTCCAAGTGATCCAAACCCAAGACTCCGATTCAGGATCTGACTCTGGATTTGAGAGATCCGAGTCTGAGGGAGA
CTTGCGAcggatcttcttggcgtcaGGAGATAACCCGCCGCCAGAGTCGACGGATCCAACACGAAGTGGCACAGACCAAGCTCCACAAGACCAAAGATCG
TCAGACCTATCGCCGCGAGAACCCAGATCGCAAATCTAGCAGGACGGGCCAAATCGCAACCGTTGTTCGCATTGTGGACCTCGTAAGCATACAGATCTCG
GCTACTGGAGACGTTTGATCTGCCAGAAATGTGGCAAGAAGGGTCACACGTCAGATCACTGCCTCTTTGTGTGTCGCGGATGTGGAGAACTGCACGATAT
GGGGAAATTCCCGGTGGAGGAGTTCTACAACCAACTGCGTCAGTGGTACGATCCGGCCAAACATGCTGGCATGCTTCCTGCCATGCCCGAGCAAATTTTA
AACTAGGACGCTCGTCAGGTTGGAATCTGGTACGAGCCGAGCGTTCTAGTGTTTGCATTTATGCATTTGGGGAAAGGAAGTCGGTAGATTAAGGCAGCGC
ACAGCAGCTAGATCTACACGATAATACATGTGATCTGCATGAGAATAGTACTGCTGTGGTCGCAAGTTTGCGTCATGTGGATGGATACGGTAGATCCGAC
GTGGTGATGTCTCTGGATCTCCTGGTAGGAGAGTCGCGAGGCTAAAAACATCACGCGCCCGGTAAATGGTTCAGACAAGCGAAAGTGACGGGGAAGATCA
ACAATGAAAAGGCGATCTTACTCTTAGATACCGGTGCCGAGGTGTCCATATTGGACACCGCCTTTGCTCGTAAGGTTGGGTGCTATATCGATACAAGTCA
GAGTCAAGATTGTGTGTGAATTGGCGAGGACGTCTACACAACGAATGGCAGAACCCGGATCAAGATCATCTTGGCAGTCTTCCTGGGTTTATTTCTTTGA
TATCTGGGTAGGCGATCTGGTTGGCCAGGATGCTATCCTAGGCATGGAATTCGTGGTACCTTCCGGGACCAGACTAGATCTATCGGATGGGTTCATTTGT
CTGCCAGATGAAGTGAAGTTCCAACTCAGCGGAAGGAGGCAGCTTCACAAACATAAAGTGAGGTTCCTGAGGCTAGATCATCATACACATGTGGGAGTCG
GGGAATCGGTAGAACTACCGAGAAGCCTCAGATCAAGAAAAACTGTGGGTCGCTAGGGGAGACCGATGTGTGCTCACAGTGACCAGCGGCCCTGGGAAAT
CAAGGTACCTGCAGATCACTGACATCAGCGGAAGCAACTTAATCTTACAAGGTGATGAGCAGATCGGAATGTAACTAACAGGGGATCGTGTACCCCGATT
TCCAGATTTCGTCTCGGTCGGATCTCGGCGTTGCAGGGAGTGGAAACATCTGGTCTTAGAAGCTACCGTGGAAGCGAGATCGGAGCATGACTCGATGGCC
GAGATCTCCGGCGGCCCAAGTGTAGATCGCCCAGATTACCCAACACCACGAGCGATactacgaagacgagaaaTGGGGCGGACGCAATGCATACCTATCA
GGTCATTGAGTGCAGACACCGGATCGGACACGTTGTCACTCGACCGACAACTCGACCGAGCGATGAAGCAAAGGTCAGAACTGGAGTACGATGCGAGGGA
CCAGACGGCCTACGCCGTCAACCCCGATCCAGCTCCCGGAAGTATAACCACGCCAAAGTTGGTGACCCAGGAAACCTTGGTCGCAGTAATCGCAGACGTA
CCGTCGGTGGGTAGGCCTGGCACAGTTGGCGAAGAAACCGGAGGTGGATCTGCAAGATGTATGAGTTCGGCCTCACCCGGGCAGAACCAGGACCCAAGTC
CCATGGCGGAGCGAGTAGAACACGGGGATCAGACTGGCCTAGACCGCGAAGAGAGGACGAATTTAGTTGGAGACGGACCGATCTGCTACCATGAAGGCGG
ATATCTACATGCGGAACAAGTCCAAGGAGGGATGGCGGTGCTGCCTGAAGTCACCATGATGACGGATGAGGTTACGATCGCCGACGTCCAGGTGGGAGAT
CCAGGGTTCAATTCGCCGGAGGAAATCGGCTGTCTACGTCGGAAAATCTGGATATACCGTCCTCTGCTTATTGGCAAAGGAAATGCGCTGCCGCCCGCAG
CCAGAGGGGTTGTATGTGACATCGATGTGGGAAACACTAGGCCGATCGCACAACGTGTTCGGAAGGTAGCCCCACAGCTCCGAGAAAAGTTGTCAAGTCT
GATCAAGGGGCTGCTAGAGGCACACATCATCCAACATTCAAGCTCCCATTGGGCGTCGCCCATAGTGGTGATAATCAAGAAGAATGGGGTGGACATACGG
CTTTGCATAGACTATAGGATGGTGAACAGCCTCACCAGGCTTATGATGTACCCGATGCCTCTGATCAACGATCTACTGGAGGATCTGGACAATATCTTGT
GGTATTGTTCACTAGATATGACGAGCGGTTTCTGGGTGGTAACGATGACGGATCGAGCTAGGGCGATCTCGGCATTTATCACGCCATTCGGTTTGTTCGA
GTGGAACCGGATGCCCTTCGGCCTCAAGAACGCCCCGCAGATCTACCAACGATTGTTGGATAACGCCTTATACGGATTTACTAGGATATCGCGATCTAAT
AACAGTCGAGAGGTCGTGGATCTGTTTGAGGGCGGGGAGCCGGAAGATCCCAGCTGACCATCTGTGTTGGGGCGTAGATCCTACATCGATGACATCCTGG
TGACGGCCAGATCCTGGGATCAGATGTGCGACCGAGTGGACGCTCTGTTGGAAACGTGCGATAAATGTAGATCAGCGTGGCGAAGTGCTCCTGGGGAAAG
CACAAAGAGGTATACCTAGGGCATCGAGTATCGAGTGAAGGCTCGAAGCTGACCCCAATGATCTGACAGCGTTAACTGGTCTACCATTCCCAGTAACGTT
GCGAGCTATGCAATCGTTCTTAGGCAGTCTGAATTATTATAGTCGTTTCATCGAAGACTATGAAGTCTACGCGGTAGTACTATACGAGCTACGGGAGGTT
GATTTcgcggcgatggcgaaggaTAGTAACCGCGAGCAGATTGAGAGGTCATTCCGAAGATCCGATCTAGACCAAGATCTGGGGGCGCAAAACCTGGAAC
CTCAGGACGCGGGAGCATCGGACATGTACGAGATCGACCAGCGATGAATACAAGGCTTTCGCTGCCCTCAAAAGGAAAATCGCGGAGACTCCGATCTTAC
GTCATTTTGACCCAGATCACCAaccagtggtggtggtagtgTACGCCAGTGACTGGGCGATCTCAGCCGCTCTGATGCAAGATTACGACGGAGTTTGTCA
CCCTGTGACTTTAGATCTGAACGACAACGTGCTGGTAGGAAAACCTATCCGGATCCTGACCCGCCACTCGACGCTGGCATGGCTGTTCCAGTCCCCAGGT
CTCCAAGGACGGCTAGGACAGTGAGAGGCATTGTTGTCCCCATGGACATTGGAGATCGTGAAATGTACCAAGGGTGAAGACGAGATCCGGGGAACACTGG
CCGCTAGCATAGCTCTGAGGTCCGAGGTGGACAGAGCTCTGGTCGCAATTGCTCCGAAAAAGGAACCTCGCCGCTAGATTCAAGCGCCGATCCCGACAGT
GCAGGTAAATGAGTCCCTCTTCGTGGTTAGTTTCGACGGATCAGCCCGGGCCAAAAGAGTGGGGGCGCGTTCGGCGCGATTCTATGGAAACTACCAGAAT
GGACAGTGATCAGGGCCAGATCCGGCTATGCCGAGGGTCTGACCGTGAATGAGGCGGAGTACAACGGGCTTCTTCTATGTTGCGATCTACTGAAGGGGAT
GGAGCGTCGGCGGCTTATGGTTTGTGGAGACTCTAACTTGATGATCCGACAGGTGAGAGGGGAGATCGATTGTAAAGTGCCCGGACTCATGCTATTAAAA
CAGAAGGCGCTATACCGACTACGGGATCTGGCCAGATCACGAACTAGTACACGTGAAACGCGATTGGAATGAAAATGCAGACAGTCTAGCTAGTGCAGCC
CTCCAACGGGGAAGAGGTATcgaagtggaggaggaaTCAGACCTGCAAGATCTCATCACGCTGAACCGGTTAAGTGATTTCCTGGCGGTTCGATCGGAGG
CGCTGATAGCGCAGATCTCACCCGTTACAACCAGATCTAGAGTCCGAACCCACTTCCGTCCTAAGGTCCTGCAAGAGGAGTTAGTGCGAGATCTCAGGAT
CGACAGTATCCGTGAGGCGCAGGACGAAGAGGCGTGGATCTCAGGGCTGAAGAAATATCTGTCTGGAGCCGTGAAAGATCTAGGACAAGCCGAAGCCAGA
TCTTGTAGTGGTATTGCGAACGACTACTAGGTGGACGACCATGATCTACATTTTTACTGCCCACTTTCAAAGAGGTCGGACGAGGATCAGGATGGCTTGA
TGAGACTGGTGGTCCCAGAGATACTCCACCGGGATATTCTACATCGTTACCACGTAAGCTTGGATAGTGGCCATCAGGAGATCGGATGTACATATCTGCG
CGTCCGGGACCGTTTTCACTGGAGTGGCCTCTATCGGAGTGTAGAGCAATATGTAGGGGAATGCGTCGATTGCGAGACCGGGAAAGGGAAGCCAACGATC
TGGGGTGAATCGCCCGGGAATATACAAGCGATCTACCCATTCCAGATCGTAGCCATGGATCATATTCTCTCATTGCCTAAATCGTACAAGGGCAATACAG
AACTGCTGATCTGCGTGGATCTGTTCACCAGATACGTGATCGCGAAAGCTAGCACGTCCCGGACGGCCCAAACTATAGACGAGTTTCTACGACGAATGCA
TATTTCGAAGATTTGGGGCTAGTGAGGCGATCCGACACAACCGGGAACCAGATTTCATGTCAGATTTCTTCCGGGCGTTCAATAAGATCTTGGGACAAAG
GCAGCGCGCTACGATGGCCTACCGGCCCCAAGCCAACGGAACAGCGGAACGCATGGTGCAAACTCTGACGCGCGCTATGTGCAAGATCGGGATCAACGAG
ATTGGAATGAGTATGCCGAACGATTAACGTTCGCGATCAACACAGCCCAGGATCGGATCAGAGGAGACACTCCGTTCTACCTGGTGCATGGATAGGATCC
GAGGACTACGTTGGAAGCCACAATCCCGGTGGGTAGTACCCGACGTCGAAACCGAGATCCACGGAGACAGCGGTACCAGGTCCACAAGAATTACCAGCAG
GCGCGAGAACAAACTAATGAAAAATTGCGTGAGGCCATCTCAGATTGGGCGGATCAACACAACGAGGGAGTCCAACCCCACCCGATCGAGGCTGGATCCC
AAGTCTGGAGCGGGTCAAGGAAGGTTACGCCCGCAAGCTGGCGCATTTGTGGCGTGGTCCGTTCCGAGTGGTCGAGCAGATCAATGACTTCACCATAAAG
TTGGAGATCACAGGTTCCGGATATCATCTATTTCCTATAGTACACGTTTCCAACCTCAAGTTGGTCAAAGCGTTCCCCGATCGGCCGAAGATCATGCTCA
ACGTCGAAGGTGGAGACCGCTTAGATCTCGATGAAGCACTGCTGCCAGAAAATAGCTGGATCCGAGATCTGGTGCTGATGAATACGAAGTGGAGGAAATC
ACCGATATGAGGACCAGTCGAAGGACTAGATATGGCCGGATCCTCCGAGAATTCTTGGTGAAATGGCGGGGATATGAAGATCAGAGCTGggtggatgaag
cagatctTAATTGTGGTGCCCTACTACATGAGGTTTTACGAGATCGCATCAGCCATCACAGGTTCGGTGTGATGCAGTCTCACGAGGAGTAGCGGGGCCG
TGACCGATCAGGATGAGTTGGTCGTTCTAGAAGAAGGATCTGCGAGGAGGTCGCAGATCGGAGGAAAGAGGTTATAcatatgtacatgtaagacTCAACA
TGGGAGACCAGATCTCCAAAACCGGATCCGGAGATATAAGAGAAGATGGCAAGAAGAGGAAAATCGAGATATTAAGAGGAGTCATCGAGTTACGCTACGG
TCATATTACTAGAGTCGGGATCAGGAGGCGGGCGAAACCTAGCGACGGATCCAGaccgaagaagatgaagttcCTCACAGCTTCGCCTCCCCAGAGCTCT
GAGATACGTTGAAGAACTTACCTGCCAAGCGTAGTCCGGTGAGAAGGGTGAGTGTCACGGAAGTGGTTGCGCCACAGGTCTGCATTACTGCATTCATCCA
GAGCCTCCAAGAGATCCGCGGGTTCGACACGGTTCAGAGTCGGATCCGCCAAGTTGGCCGACCGCGACACAATACCCAGGTACCACTTCACCGACTCTGT
CCGACAGGGGAGTGGAGGATGAATAGATCCAGCAACACACCCAGATCACACCAGCTTCCCGCATGACAGTGATCAGAACCCAGACCAAGCGTTTCCACGC
ACTCCCCGCGTGGAAGCGACGGTTCGTACGTTCCTCCCGGAACTGAAGATGCCACGGATCCGAATCTCGTAACGCAGTGGGGATGGGGAAGGAGTGGGTG
GACTCCCAAAAGGCTTGTAGGAGATCCGCCTCCAACGTCTGGTACT